\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019101727:

Variant ID: vg1019101727 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19101727
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCACGCACTTTTTTTTCCTGACTAGGATGCCATGTAAGTGAAACCACCTATATATTATATCATAGGACGTTGAGTGCACGGTTTGTGTGAGTTTAGGGT[A/G]
CATATTTCTAAATTTGTGGTTAAGGAATCTAAAAAAAAAAGGAATAAGTCCACTTTGACTCCCTTAAAAGTGACACGAATCTAATCCATGACCCTAAACC

Reverse complement sequence

GGTTTAGGGTCATGGATTAGATTCGTGTCACTTTTAAGGGAGTCAAAGTGGACTTATTCCTTTTTTTTTTAGATTCCTTAACCACAAATTTAGAAATATG[T/C]
ACCCTAAACTCACACAAACCGTGCACTCAACGTCCTATGATATAATATATAGGTGGTTTCACTTACATGGCATCCTAGTCAGGAAAAAAAAGTGCGTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 25.30% 0.30% 7.70% NA
All Indica  2759 86.60% 1.00% 0.43% 11.92% NA
All Japonica  1512 24.50% 74.30% 0.07% 1.12% NA
Aus  269 90.30% 8.60% 0.37% 0.74% NA
Indica I  595 97.60% 1.80% 0.17% 0.34% NA
Indica II  465 55.30% 0.40% 1.51% 42.80% NA
Indica III  913 98.00% 0.50% 0.00% 1.42% NA
Indica Intermediate  786 83.60% 1.30% 0.51% 14.63% NA
Temperate Japonica  767 3.80% 94.40% 0.13% 1.69% NA
Tropical Japonica  504 60.10% 39.70% 0.00% 0.20% NA
Japonica Intermediate  241 16.20% 82.60% 0.00% 1.24% NA
VI/Aromatic  96 91.70% 5.20% 0.00% 3.12% NA
Intermediate  90 66.70% 18.90% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019101727 A -> G LOC_Os10g35730.1 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:67.483; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg1019101727 A -> G LOC_Os10g35720.1 downstream_gene_variant ; 1122.0bp to feature; MODIFIER silent_mutation Average:67.483; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg1019101727 A -> G LOC_Os10g35720.2 downstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:67.483; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg1019101727 A -> G LOC_Os10g35720-LOC_Os10g35730 intergenic_region ; MODIFIER silent_mutation Average:67.483; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg1019101727 A -> DEL N N silent_mutation Average:67.483; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019101727 NA 3.19E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 7.82E-36 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 4.84E-08 5.01E-54 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 8.69E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 2.21E-06 3.63E-46 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 4.78E-14 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 8.18E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.02E-26 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 7.69E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 2.68E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 5.49E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 4.12E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.20E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 2.93E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.02E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 2.41E-51 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.39E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 3.50E-33 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.10E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 7.92E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 6.00E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 2.42E-16 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 1.44E-10 1.33E-52 mr1771_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 7.94E-08 6.07E-16 mr1771_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 1.23E-10 1.30E-57 mr1784_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 1.96E-07 2.07E-16 mr1784_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 2.61E-06 6.43E-18 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 3.18E-06 4.58E-13 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.92E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 2.32E-08 1.92E-48 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019101727 NA 1.62E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251