\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019088726:

Variant ID: vg1019088726 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 19088726
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTCATTCGACCGGTCACAGACCGGTTGAGTGCATTGCACACCGCATTAAATGCGGCGTGGCGCGACTGCTCGGGCCGCCATAAATGCGGGTAGGTGGG[T/C]
ACCTGGAGGCGGACACTTAACCCACCGTACATGGTGACCTAGAGAGGGGGTCGGGGGAGCCCGACCCCTAGTCACGGGAGCGGGCGGCCGCCGCCCAACC

Reverse complement sequence

GGTTGGGCGGCGGCCGCCCGCTCCCGTGACTAGGGGTCGGGCTCCCCCGACCCCCTCTCTAGGTCACCATGTACGGTGGGTTAAGTGTCCGCCTCCAGGT[A/G]
CCCACCTACCCGCATTTATGGCGGCCCGAGCAGTCGCGCCACGCCGCATTTAATGCGGTGTGCAATGCACTCAACCGGTCTGTGACCGGTCGAATGACCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 18.90% 7.00% 48.60% NA
All Indica  2759 1.80% 19.30% 9.06% 69.84% NA
All Japonica  1512 74.70% 2.60% 1.26% 21.49% NA
Aus  269 1.90% 77.70% 14.87% 5.58% NA
Indica I  595 2.50% 0.50% 6.72% 90.25% NA
Indica II  465 1.30% 53.80% 3.87% 41.08% NA
Indica III  913 1.30% 8.30% 14.13% 76.23% NA
Indica Intermediate  786 2.00% 26.00% 8.02% 63.99% NA
Temperate Japonica  767 94.80% 2.20% 0.39% 2.61% NA
Tropical Japonica  504 40.10% 1.20% 2.58% 56.15% NA
Japonica Intermediate  241 83.00% 6.60% 1.24% 9.13% NA
VI/Aromatic  96 5.20% 85.40% 8.33% 1.04% NA
Intermediate  90 21.10% 31.10% 15.56% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019088726 T -> C LOC_Os10g35710.1 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35710.4 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35710.2 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35710.3 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35710.5 upstream_gene_variant ; 3944.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35690.1 downstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> C LOC_Os10g35690-LOC_Os10g35710 intergenic_region ; MODIFIER silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N
vg1019088726 T -> DEL N N silent_mutation Average:31.255; most accessible tissue: Minghui63 root, score: 57.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019088726 NA 6.52E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.23E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.91E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.93E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 1.80E-06 1.84E-51 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 8.79E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 6.59E-44 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.85E-13 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.25E-27 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 4.86E-11 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 3.42E-50 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.72E-12 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 9.06E-08 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.47E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.42E-53 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 4.86E-11 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.16E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 4.68E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 3.54E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.93E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 7.86E-10 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 7.59E-08 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 3.51E-33 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 9.98E-29 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 5.03E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.56E-36 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 8.55E-10 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 4.82E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 5.31E-10 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 3.26E-10 8.41E-53 mr1771_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 1.06E-06 7.04E-16 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 2.90E-10 4.21E-58 mr1784_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 2.33E-06 4.91E-17 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 2.07E-06 2.12E-18 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 2.46E-13 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 NA 1.19E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 2.43E-09 6.76E-50 mr1862_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726 1.07E-06 1.88E-14 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251