Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019088726:

Variant ID: vg1019088726 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19088726
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTCATTCGACCGGTCACAGACCGGTTGAGTGCATTGCACACCGCATTAAATGCGGCGTGGCGCGACTGCTCGGGCCGCCATAAATGCGGGTAGGTGGG[T/C]
ACCTGGAGGCGGACACTTAACCCACCGTACATGGTGACCTAGAGAGGGGGTCGGGGGAGCCCGACCCCTAGTCACGGGAGCGGGCGGCCGCCGCCCAACC

Reverse complement sequence

GGTTGGGCGGCGGCCGCCCGCTCCCGTGACTAGGGGTCGGGCTCCCCCGACCCCCTCTCTAGGTCACCATGTACGGTGGGTTAAGTGTCCGCCTCCAGGT[A/G]
CCCACCTACCCGCATTTATGGCGGCCCGAGCAGTCGCGCCACGCCGCATTTAATGCGGTGTGCAATGCACTCAACCGGTCTGTGACCGGTCGAATGACCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.50%	18.90%	7.00%	48.60%	NA
All Indica	2759	1.80%	19.30%	9.06%	69.84%	NA
All Japonica	1512	74.70%	2.60%	1.26%	21.49%	NA
Aus	269	1.90%	77.70%	14.87%	5.58%	NA
Indica I	595	2.50%	0.50%	6.72%	90.25%	NA
Indica II	465	1.30%	53.80%	3.87%	41.08%	NA
Indica III	913	1.30%	8.30%	14.13%	76.23%	NA
Indica Intermediate	786	2.00%	26.00%	8.02%	63.99%	NA
Temperate Japonica	767	94.80%	2.20%	0.39%	2.61%	NA
Tropical Japonica	504	40.10%	1.20%	2.58%	56.15%	NA
Japonica Intermediate	241	83.00%	6.60%	1.24%	9.13%	NA
VI/Aromatic	96	5.20%	85.40%	8.33%	1.04%	NA
Intermediate	90	21.10%	31.10%	15.56%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019088726	T -> C	LOC_Os10g35710.1	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35710.4	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35710.2	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35710.3	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35710.5	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35690.1	downstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> C	LOC_Os10g35690-LOC_Os10g35710	intergenic_region ; MODIFIER	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg1019088726	T -> DEL	N	N	silent_mutation	Average:31.255; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019088726	NA	6.52E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.23E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.91E-21	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.93E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	1.80E-06	1.84E-51	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	8.79E-15	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	6.59E-44	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.85E-13	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.25E-27	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	4.86E-11	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	3.42E-50	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.72E-12	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	9.06E-08	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.47E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.42E-53	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	4.86E-11	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.16E-08	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	4.68E-13	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	3.54E-08	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.93E-36	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	7.86E-10	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	7.59E-08	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	3.51E-33	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	9.98E-29	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	5.03E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.56E-36	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	8.55E-10	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	4.82E-09	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	5.31E-10	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	3.26E-10	8.41E-53	mr1771_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	1.06E-06	7.04E-16	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	2.90E-10	4.21E-58	mr1784_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	2.33E-06	4.91E-17	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	2.07E-06	2.12E-18	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	2.46E-13	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	NA	1.19E-09	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	2.43E-09	6.76E-50	mr1862_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019088726	1.07E-06	1.88E-14	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251