\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019048612:

Variant ID: vg1019048612 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 19048612
Reference Allele: CAlternative Allele: T,CT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTACCGTAAATTATGAGGTTTTCAAAACTGATATGTTTTTACCCTCTATAAACATAAAAAAAATTCCAAACTTTAAAAAATAATTGTATCCTAACTTTT[C/T,CT]
TTTTTTAGAGAATTACACACTCACCCCCGTAAATCCATCCTGGACTCTCATAGGGAGTCGAACATTTGAGAATTACACACTCACCCCGTAAATCCATCCT

Reverse complement sequence

AGGATGGATTTACGGGGTGAGTGTGTAATTCTCAAATGTTCGACTCCCTATGAGAGTCCAGGATGGATTTACGGGGGTGAGTGTGTAATTCTCTAAAAAA[G/A,AG]
AAAAGTTAGGATACAATTATTTTTTAAAGTTTGGAATTTTTTTTATGTTTATAGAGGGTAAAAACATATCAGTTTTGAAAACCTCATAATTTACGGTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 28.70% 7.91% 21.86% CT: 0.06%
All Indica  2759 61.30% 5.50% 9.60% 23.52% CT: 0.04%
All Japonica  1512 15.50% 75.40% 4.23% 4.89% NA
Aus  269 1.50% 12.60% 11.15% 74.72% NA
Indica I  595 80.20% 3.00% 9.24% 7.56% NA
Indica II  465 27.10% 9.20% 8.39% 55.27% NA
Indica III  913 70.50% 4.70% 8.87% 15.88% NA
Indica Intermediate  786 56.50% 6.20% 11.45% 25.70% CT: 0.13%
Temperate Japonica  767 2.30% 95.00% 0.39% 2.22% NA
Tropical Japonica  504 39.70% 41.90% 10.12% 8.33% NA
Japonica Intermediate  241 6.60% 83.00% 4.15% 6.22% NA
VI/Aromatic  96 3.10% 5.20% 3.12% 88.54% NA
Intermediate  90 31.10% 26.70% 13.33% 26.67% CT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1019048612 C -> CT LOC_Os10g35604.1 downstream_gene_variant ; 2353.0bp to feature; MODIFIER silent_mutation Average:81.214; most accessible tissue: Minghui63 flower, score: 91.346 N N N N
vg1019048612 C -> CT LOC_Os10g35604-LOC_Os10g35630 intergenic_region ; MODIFIER silent_mutation Average:81.214; most accessible tissue: Minghui63 flower, score: 91.346 N N N N
vg1019048612 C -> T LOC_Os10g35604.1 downstream_gene_variant ; 2352.0bp to feature; MODIFIER silent_mutation Average:81.214; most accessible tissue: Minghui63 flower, score: 91.346 N N N N
vg1019048612 C -> T LOC_Os10g35604-LOC_Os10g35630 intergenic_region ; MODIFIER silent_mutation Average:81.214; most accessible tissue: Minghui63 flower, score: 91.346 N N N N
vg1019048612 C -> DEL N N silent_mutation Average:81.214; most accessible tissue: Minghui63 flower, score: 91.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1019048612 C CT 0.0 -0.03 -0.09 0.06 0.04 0.03
vg1019048612 C T 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1019048612 NA 1.42E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.89E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 5.72E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 5.39E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 2.64E-16 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.94E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.50E-18 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 9.59E-06 NA mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.07E-18 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.57E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 3.55E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 3.65E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 2.55E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 6.31E-22 mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 5.88E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 2.33E-21 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 6.88E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 9.62E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 9.65E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 6.97E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.38E-22 mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 1.15E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.37E-14 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 2.48E-11 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 1.68E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 1.38E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 1.13E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019048612 NA 4.84E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251