\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018998107:

Variant ID: vg1018998107 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18998107
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTAAAAAGCATGTTTCCCTTCTTAGGCAGCGAGAGGCCCATGTGGTGACCCCTGACCAGAGAAAAAGGAGGCCCAGGCTTAGAAAGAGAGAAAAAAAAG[G/A]
AGAGGGGAGTTGGGACTCTGGCGAATGGGTTCTAGAGCCTGAACTCTCTCTCGCTCTCCGGCTCTCTGTATTCCTTCACATACAGATCCACCAGAACACA

Reverse complement sequence

TGTGTTCTGGTGGATCTGTATGTGAAGGAATACAGAGAGCCGGAGAGCGAGAGAGAGTTCAGGCTCTAGAACCCATTCGCCAGAGTCCCAACTCCCCTCT[C/T]
CTTTTTTTTCTCTCTTTCTAAGCCTGGGCCTCCTTTTTCTCTGGTCAGGGGTCACCACATGGGCCTCTCGCTGCCTAAGAAGGGAAACATGCTTTTTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.80% 2.20% 8.82% 63.10% NA
All Indica  2759 2.40% 0.90% 6.05% 90.69% NA
All Japonica  1512 74.70% 0.00% 1.19% 24.07% NA
Aus  269 0.70% 24.90% 62.83% 11.52% NA
Indica I  595 4.20% 0.00% 7.73% 88.07% NA
Indica II  465 2.20% 0.20% 1.72% 95.91% NA
Indica III  913 1.80% 1.00% 4.71% 92.55% NA
Indica Intermediate  786 1.90% 1.80% 8.91% 87.40% NA
Temperate Japonica  767 94.70% 0.00% 0.00% 5.35% NA
Tropical Japonica  504 40.70% 0.00% 1.98% 57.34% NA
Japonica Intermediate  241 82.60% 0.00% 3.32% 14.11% NA
VI/Aromatic  96 2.10% 11.50% 55.21% 31.25% NA
Intermediate  90 23.30% 4.40% 11.11% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018998107 G -> A LOC_Os10g35510.1 upstream_gene_variant ; 59.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35520.1 upstream_gene_variant ; 692.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35530.1 upstream_gene_variant ; 4107.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35530.2 upstream_gene_variant ; 4107.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35500.1 downstream_gene_variant ; 1291.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35500.2 downstream_gene_variant ; 1308.0bp to feature; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> A LOC_Os10g35510-LOC_Os10g35520 intergenic_region ; MODIFIER silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1018998107 G -> DEL N N silent_mutation Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018998107 NA 5.66E-10 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.17E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 4.69E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 5.60E-10 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 6.35E-06 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.05E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 7.89E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.45E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 7.37E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 2.94E-07 1.33E-54 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 4.95E-18 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 9.48E-08 4.49E-49 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.02E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 9.65E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 4.54E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.01E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 1.55E-06 7.81E-31 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 3.26E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.99E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.11E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.39E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 7.52E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 3.01E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.17E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.77E-34 mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.03E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 5.88E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 3.80E-07 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.36E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 1.68E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 3.04E-08 4.22E-52 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.17E-14 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 6.78E-09 3.89E-57 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.14E-15 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 7.91E-15 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 4.13E-06 9.51E-18 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 6.94E-12 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 2.70E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 8.08E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 1.69E-07 3.74E-50 mr1862_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107 NA 6.41E-13 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251