Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018998107:

Variant ID: vg1018998107 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18998107
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTAAAAAGCATGTTTCCCTTCTTAGGCAGCGAGAGGCCCATGTGGTGACCCCTGACCAGAGAAAAAGGAGGCCCAGGCTTAGAAAGAGAGAAAAAAAAG[G/A]
AGAGGGGAGTTGGGACTCTGGCGAATGGGTTCTAGAGCCTGAACTCTCTCTCGCTCTCCGGCTCTCTGTATTCCTTCACATACAGATCCACCAGAACACA

Reverse complement sequence

TGTGTTCTGGTGGATCTGTATGTGAAGGAATACAGAGAGCCGGAGAGCGAGAGAGAGTTCAGGCTCTAGAACCCATTCGCCAGAGTCCCAACTCCCCTCT[C/T]
CTTTTTTTTCTCTCTTTCTAAGCCTGGGCCTCCTTTTTCTCTGGTCAGGGGTCACCACATGGGCCTCTCGCTGCCTAAGAAGGGAAACATGCTTTTTACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.80%	2.20%	8.82%	63.10%	NA
All Indica	2759	2.40%	0.90%	6.05%	90.69%	NA
All Japonica	1512	74.70%	0.00%	1.19%	24.07%	NA
Aus	269	0.70%	24.90%	62.83%	11.52%	NA
Indica I	595	4.20%	0.00%	7.73%	88.07%	NA
Indica II	465	2.20%	0.20%	1.72%	95.91%	NA
Indica III	913	1.80%	1.00%	4.71%	92.55%	NA
Indica Intermediate	786	1.90%	1.80%	8.91%	87.40%	NA
Temperate Japonica	767	94.70%	0.00%	0.00%	5.35%	NA
Tropical Japonica	504	40.70%	0.00%	1.98%	57.34%	NA
Japonica Intermediate	241	82.60%	0.00%	3.32%	14.11%	NA
VI/Aromatic	96	2.10%	11.50%	55.21%	31.25%	NA
Intermediate	90	23.30%	4.40%	11.11%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018998107	G -> A	LOC_Os10g35510.1	upstream_gene_variant ; 59.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35520.1	upstream_gene_variant ; 692.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35530.1	upstream_gene_variant ; 4107.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35530.2	upstream_gene_variant ; 4107.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35500.1	downstream_gene_variant ; 1291.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35500.2	downstream_gene_variant ; 1308.0bp to feature; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> A	LOC_Os10g35510-LOC_Os10g35520	intergenic_region ; MODIFIER	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1018998107	G -> DEL	N	N	silent_mutation	Average:23.671; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018998107	NA	5.66E-10	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.17E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	4.69E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	5.60E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	6.35E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.05E-11	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	7.89E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.45E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	7.37E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	2.94E-07	1.33E-54	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	4.95E-18	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	9.48E-08	4.49E-49	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.02E-15	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	9.65E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	4.54E-09	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.01E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	1.55E-06	7.81E-31	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	3.26E-08	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.99E-30	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.11E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.39E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	7.52E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	3.01E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.17E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.77E-34	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.03E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	5.88E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	3.80E-07	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.36E-06	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	1.68E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	3.04E-08	4.22E-52	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.17E-14	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	6.78E-09	3.89E-57	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.14E-15	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	7.91E-15	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	4.13E-06	9.51E-18	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	6.94E-12	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	2.70E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	8.08E-08	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	1.69E-07	3.74E-50	mr1862_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018998107	NA	6.41E-13	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251