\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018943301:

Variant ID: vg1018943301 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18943301
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGCACAGTGCTGGAGTCGCTGGCCACTGCGGTTCCGCGTTTTGGAACCGCGGGACCGTCGCGATTCCGCGTTTTGGAGCTGCCGGACCATGACGGTTCC[G/A]
CGCAGGATCGTCGGTCCCGTATTTTGAATCTGCGGAACCGTCGCTGTCCCGCGTTTCCGTTTCGCGGGATGCGTATATTTTTATAAAACCTCTCCATGCA

Reverse complement sequence

TGCATGGAGAGGTTTTATAAAAATATACGCATCCCGCGAAACGGAAACGCGGGACAGCGACGGTTCCGCAGATTCAAAATACGGGACCGACGATCCTGCG[C/T]
GGAACCGTCATGGTCCGGCAGCTCCAAAACGCGGAATCGCGACGGTCCCGCGGTTCCAAAACGCGGAACCGCAGTGGCCAGCGACTCCAGCACTGTGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 6.60% 1.31% 0.00% NA
All Indica  2759 97.60% 1.60% 0.87% 0.00% NA
All Japonica  1512 80.00% 17.70% 2.25% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 94.10% 3.00% 2.86% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.00% 0.64% 0.00% NA
Temperate Japonica  767 98.00% 1.20% 0.78% 0.00% NA
Tropical Japonica  504 47.40% 47.40% 5.16% 0.00% NA
Japonica Intermediate  241 90.90% 8.30% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018943301 G -> A LOC_Os10g35436.1 downstream_gene_variant ; 728.0bp to feature; MODIFIER silent_mutation Average:89.194; most accessible tissue: Zhenshan97 panicle, score: 98.298 N N N N
vg1018943301 G -> A LOC_Os10g35436-LOC_Os10g35440 intergenic_region ; MODIFIER silent_mutation Average:89.194; most accessible tissue: Zhenshan97 panicle, score: 98.298 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018943301 G A -0.01 -0.01 -0.03 -0.05 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018943301 NA 8.05E-17 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 1.13E-14 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 1.21E-07 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 1.25E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 7.79E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 3.87E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 2.27E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 3.81E-14 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 1.77E-07 3.62E-14 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018943301 NA 1.13E-12 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251