\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018726980:

Variant ID: vg1018726980 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18726980
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTTTTTATCTAGTGGCCGAAACTAATTTTTTGGTGACAGCTGGTAGGAGGGTCTTTAGTGCCGGTTTTTAATTAAAATCGGCATCAATACTCCTCTCT[T/C]
AGTGGGATTGGGATTTGGCGAGAAATGCTTTATAGGCGCCGATTTTTTTTTCAAACCGGCACATATAAGACCGGTATATATATATATATATATATATATA

Reverse complement sequence

TATATATATATATATATATATATATACCGGTCTTATATGTGCCGGTTTGAAAAAAAAATCGGCGCCTATAAAGCATTTCTCGCCAAATCCCAATCCCACT[A/G]
AGAGAGGAGTATTGATGCCGATTTTAATTAAAAACCGGCACTAAAGACCCTCCTACCAGCTGTCACCAAAAAATTAGTTTCGGCCACTAGATAAAAACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.00% 6.80% 22.39% 48.77% NA
All Indica  2759 0.40% 7.00% 30.99% 61.69% NA
All Japonica  1512 66.70% 6.60% 6.22% 20.50% NA
Aus  269 1.50% 3.30% 27.88% 67.29% NA
Indica I  595 0.30% 6.40% 21.18% 72.10% NA
Indica II  465 0.40% 5.80% 47.10% 46.67% NA
Indica III  913 0.20% 8.70% 27.93% 63.20% NA
Indica Intermediate  786 0.50% 6.10% 32.44% 60.94% NA
Temperate Japonica  767 86.40% 6.90% 4.17% 2.48% NA
Tropical Japonica  504 33.50% 5.20% 9.33% 51.98% NA
Japonica Intermediate  241 73.00% 8.70% 6.22% 12.03% NA
VI/Aromatic  96 3.10% 15.60% 10.42% 70.83% NA
Intermediate  90 17.80% 6.70% 26.67% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018726980 T -> C LOC_Os10g35090.1 upstream_gene_variant ; 4626.0bp to feature; MODIFIER silent_mutation Average:78.514; most accessible tissue: Callus, score: 94.578 N N N N
vg1018726980 T -> C LOC_Os10g35100.1 upstream_gene_variant ; 1497.0bp to feature; MODIFIER silent_mutation Average:78.514; most accessible tissue: Callus, score: 94.578 N N N N
vg1018726980 T -> C LOC_Os10g35100-LOC_Os10g35110 intergenic_region ; MODIFIER silent_mutation Average:78.514; most accessible tissue: Callus, score: 94.578 N N N N
vg1018726980 T -> DEL N N silent_mutation Average:78.514; most accessible tissue: Callus, score: 94.578 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018726980 T C 0.0 0.02 0.02 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018726980 8.36E-07 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 1.43E-07 NA mr1178 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 4.67E-06 3.98E-12 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 6.12E-20 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 4.97E-07 1.49E-11 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 1.47E-06 mr1342 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 6.95E-07 1.33E-18 mr1361 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 2.91E-07 2.91E-07 mr1361 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 2.95E-11 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 5.11E-08 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 9.17E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 5.56E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 4.31E-06 mr1509 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 3.28E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 6.03E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 1.57E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 4.37E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 5.24E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 7.43E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 5.24E-06 7.26E-46 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 3.33E-39 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 4.04E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 3.83E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 8.35E-15 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 9.68E-07 6.41E-29 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 1.41E-08 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 6.76E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 1.53E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 2.76E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 2.81E-30 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 4.70E-41 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 1.76E-44 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 5.39E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 3.48E-14 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 5.41E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018726980 NA 2.88E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251