Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018654414:

Variant ID: vg1018654414 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18654414
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTATATGTGTATTCGCATTTACGATTGGTTATATTTTAAGTGGTAAATAAATGAAATATACGTTGAGAGTGAGATGCTTGTGATTATCTAATTAATCT[T/C]
AAAATATACTACTTAATTTTTCGGAGATGCTTGTGTGTGTTTTATAAGGATAAGTGTGGACAAGCTGTATTGCTGTTCTAATAATTTTGCTGAGAATGTA

Reverse complement sequence

TACATTCTCAGCAAAATTATTAGAACAGCAATACAGCTTGTCCACACTTATCCTTATAAAACACACACAAGCATCTCCGAAAAATTAAGTAGTATATTTT[A/G]
AGATTAATTAGATAATCACAAGCATCTCACTCTCAACGTATATTTCATTTATTTACCACTTAAAATATAACCAATCGTAAATGCGAATACACATATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	27.50%	0.13%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.14%	0.00%	NA
All Japonica	1512	24.20%	75.70%	0.13%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.30%	0.38%	0.00%	NA
Temperate Japonica	767	7.20%	92.70%	0.13%	0.00%	NA
Tropical Japonica	504	56.00%	43.80%	0.20%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018654414	T -> C	LOC_Os10g34940.1	upstream_gene_variant ; 2135.0bp to feature; MODIFIER	silent_mutation	Average:60.177; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg1018654414	T -> C	LOC_Os10g34960.1	downstream_gene_variant ; 4124.0bp to feature; MODIFIER	silent_mutation	Average:60.177; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N
vg1018654414	T -> C	LOC_Os10g34930-LOC_Os10g34940	intergenic_region ; MODIFIER	silent_mutation	Average:60.177; most accessible tissue: Zhenshan97 root, score: 82.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018654414	5.80E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	5.21E-09	1.85E-51	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	2.19E-16	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	2.52E-07	1.33E-44	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	1.25E-13	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	3.70E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	1.85E-10	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	3.65E-19	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	6.54E-06	2.04E-27	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	4.93E-09	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	4.59E-15	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	1.55E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	4.87E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	3.73E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	5.40E-08	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	1.27E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	6.27E-08	NA	mr1757_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	1.65E-06	6.15E-47	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	4.04E-12	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	2.62E-46	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	7.04E-12	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	2.00E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	1.07E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	4.46E-42	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018654414	NA	2.79E-10	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251