\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018636735:

Variant ID: vg1018636735 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18636735
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGGACACGAATGAAAAAACTAATTTCAGAACTCGCCGGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAAGCCGTCATTAGCACATGTGGGTTACT[A/G]
TAGCACTTATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCGCTATTTCCCCATAACTGTACAATTAGTTTTTTCTTTTTATTTATATTTAA

Reverse complement sequence

TTAAATATAAATAAAAAGAAAAAACTAATTGTACAGTTATGGGGAAATAGCGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTGCTA[T/C]
AGTAACCCACATGTGCTAATGACGGCTTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCCGGCGAGTTCTGAAATTAGTTTTTTCATTCGTGTCCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 25.70% 0.08% 1.08% NA
All Indica  2759 98.80% 0.60% 0.07% 0.51% NA
All Japonica  1512 24.20% 75.80% 0.00% 0.00% NA
Aus  269 84.80% 0.70% 0.74% 13.75% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.10% 0.11% 0.55% NA
Indica Intermediate  786 97.70% 1.10% 0.00% 1.15% NA
Temperate Japonica  767 6.30% 93.70% 0.00% 0.00% NA
Tropical Japonica  504 56.00% 44.00% 0.00% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018636735 A -> G LOC_Os10g34902.1 upstream_gene_variant ; 4769.0bp to feature; MODIFIER silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1018636735 A -> G LOC_Os10g34910.1 upstream_gene_variant ; 561.0bp to feature; MODIFIER silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1018636735 A -> G LOC_Os10g34930.1 upstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1018636735 A -> G LOC_Os10g34920.1 downstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1018636735 A -> G LOC_Os10g34910-LOC_Os10g34920 intergenic_region ; MODIFIER silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N
vg1018636735 A -> DEL N N silent_mutation Average:55.369; most accessible tissue: Zhenshan97 root, score: 92.495 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1018636735 A G 0.01 0.03 0.01 0.0 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018636735 NA 2.41E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 8.44E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.94E-12 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.63E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 2.12E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 6.14E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 9.63E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.19E-11 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 8.66E-08 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 5.56E-11 1.15E-47 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 8.26E-19 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 5.19E-07 4.60E-37 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.40E-15 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 8.00E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 5.82E-08 1.03E-08 mr1800 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 2.43E-12 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 6.96E-07 1.13E-26 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 7.86E-11 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 3.84E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 7.34E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.77E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.27E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 1.69E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 2.36E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018636735 NA 5.57E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251