\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018632917:

Variant ID: vg1018632917 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18632917
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGAAACGGAGGAGTAGTATATTATAGAGATCAACAAGTATGTGTCAAATTATCTTCCTCACATTATTTTCTCAATATTTCAAGTTTCATCATTTCGA[T/C]
AATATTTAACATATACCCATCTATAAATCCCGCAGCAAAGCGCGAGGTATCACATAGTATAGTTGATGTTTGGGCCAAAACTGAACTAAACTCCATATTG

Reverse complement sequence

CAATATGGAGTTTAGTTCAGTTTTGGCCCAAACATCAACTATACTATGTGATACCTCGCGCTTTGCTGCGGGATTTATAGATGGGTATATGTTAAATATT[A/G]
TCGAAATGATGAAACTTGAAATATTGAGAAAATAATGTGAGGAAGATAATTTGACACATACTTGTTGATCTCTATAATATACTACTCCTCCGTTTCACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 17.50% 0.17% 0.87% NA
All Indica  2759 72.60% 26.90% 0.11% 0.43% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 75.80% 11.50% 1.86% 10.78% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 36.80% 63.20% 0.00% 0.00% NA
Indica III  913 72.10% 27.40% 0.00% 0.55% NA
Indica Intermediate  786 75.30% 23.40% 0.38% 0.89% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018632917 T -> C LOC_Os10g34890.1 upstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> C LOC_Os10g34896.1 upstream_gene_variant ; 3505.0bp to feature; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> C LOC_Os10g34902.1 upstream_gene_variant ; 951.0bp to feature; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> C LOC_Os10g34910.1 downstream_gene_variant ; 2422.0bp to feature; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> C LOC_Os10g34920.1 downstream_gene_variant ; 4572.0bp to feature; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> C LOC_Os10g34902-LOC_Os10g34910 intergenic_region ; MODIFIER silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg1018632917 T -> DEL N N silent_mutation Average:68.536; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018632917 NA 2.10E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1018632917 NA 6.59E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 2.92E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 1.07E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 5.04E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 3.55E-09 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 5.40E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 6.24E-09 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 2.41E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 4.13E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 4.88E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 8.16E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 8.95E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 1.54E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 7.81E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 1.65E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 3.01E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 9.86E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 6.01E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 4.47E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 5.16E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 8.45E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 9.46E-08 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 6.63E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 1.99E-06 6.56E-09 mr1862_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018632917 NA 7.10E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251