\
| Variant ID: vg1018616939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18616939 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 182. )
CTTGTGTACGACAACTGTGCTACCTGCATTTCAATTTGTTAGTATCAAATAAAGTGTTGTGACATGCATTTTTCTATGTTACTTGTTTATTCAAATTACC[G/A]
GTGTAGTATGTGACTTAAGCATGGTTAACTCATCATGTAGTAATGCTGGGCTTTGTGGCGATTGGGTTGTGCCGATTCCTGTGAATTGAAAAGCATGATG
CATCATGCTTTTCAATTCACAGGAATCGGCACAACCCAATCGCCACAAAGCCCAGCATTACTACATGATGAGTTAACCATGCTTAAGTCACATACTACAC[C/T]
GGTAATTTGAATAAACAAGTAACATAGAAAAATGCATGTCACAACACTTTATTTGATACTAACAAATTGAAATGCAGGTAGCACAGTTGTCGTACACAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.40% | 31.50% | 2.48% | 20.59% | NA |
| All Indica | 2759 | 73.00% | 3.40% | 2.86% | 20.70% | NA |
| All Japonica | 1512 | 1.70% | 87.50% | 0.73% | 10.05% | NA |
| Aus | 269 | 24.90% | 1.90% | 5.95% | 67.29% | NA |
| Indica I | 595 | 81.00% | 3.50% | 4.20% | 11.26% | NA |
| Indica II | 465 | 74.00% | 2.20% | 2.15% | 21.72% | NA |
| Indica III | 913 | 72.10% | 3.00% | 1.42% | 23.55% | NA |
| Indica Intermediate | 786 | 67.40% | 4.70% | 3.94% | 23.92% | NA |
| Temperate Japonica | 767 | 1.30% | 96.20% | 0.13% | 2.35% | NA |
| Tropical Japonica | 504 | 2.60% | 73.80% | 1.79% | 21.83% | NA |
| Japonica Intermediate | 241 | 1.20% | 88.40% | 0.41% | 9.96% | NA |
| VI/Aromatic | 96 | 3.10% | 45.80% | 3.12% | 47.92% | NA |
| Intermediate | 90 | 40.00% | 25.60% | 8.89% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018616939 | G -> A | LOC_Os10g34884.1 | missense_variant&splice_region_variant ; p.Pro261Leu; MODERATE | nonsynonymous_codon ; P261L | Average:34.205; most accessible tissue: Callus, score: 61.326 | unknown | unknown | TOLERATED | 0.31 |
| vg1018616939 | G -> DEL | LOC_Os10g34884.1 | N | frameshift_variant | Average:34.205; most accessible tissue: Callus, score: 61.326 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018616939 | NA | 6.48E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.23E-38 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 5.73E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | 7.82E-07 | 1.10E-06 | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.41E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.04E-12 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 6.86E-52 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.78E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 4.51E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 7.00E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 2.34E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.63E-10 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 8.22E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 1.02E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 3.69E-16 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 5.09E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 2.79E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018616939 | NA | 8.77E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |