| Variant ID: vg1018579412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18579412 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 204. )
AGTACTAAAATTTTATTGTAATATTTAGTACATTATGATCTATACCTGATGTATCAAGATGTACCAAATTATAAGAAAAGAATACCTCTATGAATTTAAT[A/G]
ACCATAAAATCACACAATAAAAAAATAGTACCACGGTAGTACGCATGATACATTGATATACCCACATCTGTATTTCTGTTTGTCACATGAATGGGAGTGG
CCACTCCCATTCATGTGACAAACAGAAATACAGATGTGGGTATATCAATGTATCATGCGTACTACCGTGGTACTATTTTTTTATTGTGTGATTTTATGGT[T/C]
ATTAAATTCATAGAGGTATTCTTTTCTTATAATTTGGTACATCTTGATACATCAGGTATAGATCATAATGTACTAAATATTACAATAAAATTTTAGTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 27.00% | 0.04% | 0.02% | NA |
| All Indica | 2759 | 98.70% | 1.20% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 22.90% | 77.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 55.00% | 44.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018579412 | A -> G | LOC_Os10g34790.1 | upstream_gene_variant ; 3556.0bp to feature; MODIFIER | silent_mutation | Average:42.897; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1018579412 | A -> G | LOC_Os10g34795.1 | downstream_gene_variant ; 493.0bp to feature; MODIFIER | silent_mutation | Average:42.897; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1018579412 | A -> G | LOC_Os10g34790-LOC_Os10g34795 | intergenic_region ; MODIFIER | silent_mutation | Average:42.897; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1018579412 | A -> DEL | N | N | silent_mutation | Average:42.897; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018579412 | NA | 2.87E-54 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1018579412 | NA | 1.40E-12 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 7.46E-36 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 3.01E-13 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 1.24E-76 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 5.61E-11 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 2.58E-59 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 1.50E-08 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | NA | 3.74E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018579412 | 5.82E-07 | 1.38E-62 | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/