RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1018570054:

Variant ID: vg1018570054 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18570054
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCATATAGATATTAATGAATCTAGACACACATATATGTTTAGATTCATTAACATTTATATGAATGTGGGTAATGCTCGAAAGTTTTACATTATGAAACG[G/A]
ATAAACTAGTATATAGCTGGATCACAAAGATACTGCAAGTTAAGAAAACACATGTCTGTAAATTATTAAGGGTATATTTTTTTTCTTATCTTTATTAACT

Reverse complement sequence

AGTTAATAAAGATAAGAAAAAAAATATACCCTTAATAATTTACAGACATGTGTTTTCTTAACTTGCAGTATCTTTGTGATCCAGCTATATACTAGTTTAT[C/T]
CGTTTCATAATGTAAAACTTTCGAGCATTACCCACATTCATATAAATGTTAATGAATCTAAACATATATGTGTGTCTAGATTCATTAATATCTATATGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	26.50%	0.02%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.04%	0.00%	NA
All Japonica	1512	22.80%	77.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	54.40%	45.60%	0.00%	0.00%	NA
Japonica Intermediate	241	14.90%	85.10%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018570054	G -> A	LOC_Os10g34770.1	upstream_gene_variant ; 4568.0bp to feature; MODIFIER	silent_mutation	Average:42.2; most accessible tissue: Callus, score: 69.044	N	N	N	N
vg1018570054	G -> A	LOC_Os10g34790.1	downstream_gene_variant ; 3485.0bp to feature; MODIFIER	silent_mutation	Average:42.2; most accessible tissue: Callus, score: 69.044	N	N	N	N
vg1018570054	G -> A	LOC_Os10g34770-LOC_Os10g34790	intergenic_region ; MODIFIER	silent_mutation	Average:42.2; most accessible tissue: Callus, score: 69.044	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018570054	NA	3.11E-34	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1018570054	NA	3.81E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	1.47E-34	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	3.77E-11	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	1.08E-74	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	1.51E-09	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	2.07E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	2.24E-60	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	6.37E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018570054	NA	1.79E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 76 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg1018570054:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact