Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018561974:

Variant ID: vg1018561974 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18561974
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGAATAGGCTAATTTAAAATTTTATGCGGAAGCTAAAACTAAAATAAGGTCGGAAAGTCTGATCCACAGTCAGATTATCCGAAAATATCAGATAGTCT[G/C]
ATGTCTGATCCACCAATGAAGCACAACAAGTAGATCTATAATACAAGCAAGAGTAAAGCACAAACAGTGACTAGATCTATAGCGGCACAATTAAGCAAAG

Reverse complement sequence

CTTTGCTTAATTGTGCCGCTATAGATCTAGTCACTGTTTGTGCTTTACTCTTGCTTGTATTATAGATCTACTTGTTGTGCTTCATTGGTGGATCAGACAT[C/G]
AGACTATCTGATATTTTCGGATAATCTGACTGTGGATCAGACTTTCCGACCTTATTTTAGTTTTAGCTTCCGCATAAAATTTTAAATTAGCCTATTCACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	30.40%	3.96%	0.87%	NA
All Indica	2759	93.10%	2.00%	3.55%	1.38%	NA
All Japonica	1512	22.00%	78.00%	0.00%	0.00%	NA
Aus	269	41.30%	27.90%	30.86%	0.00%	NA
Indica I	595	94.50%	2.20%	1.34%	2.02%	NA
Indica II	465	89.50%	0.60%	8.17%	1.72%	NA
Indica III	913	96.10%	2.20%	1.42%	0.33%	NA
Indica Intermediate	786	90.70%	2.40%	4.96%	1.91%	NA
Temperate Japonica	767	4.00%	96.00%	0.00%	0.00%	NA
Tropical Japonica	504	54.00%	46.00%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	96.90%	3.12%	0.00%	NA
Intermediate	90	57.80%	35.60%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018561974	G -> C	LOC_Os10g34750.1	upstream_gene_variant ; 2647.0bp to feature; MODIFIER	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N
vg1018561974	G -> C	LOC_Os10g34760.1	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N
vg1018561974	G -> C	LOC_Os10g34750.2	upstream_gene_variant ; 2647.0bp to feature; MODIFIER	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N
vg1018561974	G -> C	LOC_Os10g34770.1	downstream_gene_variant ; 3024.0bp to feature; MODIFIER	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N
vg1018561974	G -> C	LOC_Os10g34760-LOC_Os10g34770	intergenic_region ; MODIFIER	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N
vg1018561974	G -> DEL	N	N	silent_mutation	Average:36.008; most accessible tissue: Callus, score: 64.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018561974	NA	2.68E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.73E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	4.49E-06	2.47E-11	mr1129	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	2.65E-13	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	9.32E-08	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	5.44E-12	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	2.81E-09	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	3.45E-13	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	7.90E-09	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	9.38E-11	1.09E-54	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	5.55E-08	6.99E-23	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	1.87E-07	3.46E-45	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	5.62E-07	8.52E-19	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	2.82E-11	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.19E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	4.85E-06	2.22E-29	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.89E-10	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	5.90E-15	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	6.57E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	9.73E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	3.13E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	5.41E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.06E-13	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	3.64E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	8.93E-06	4.04E-46	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	4.42E-13	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	2.42E-46	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	3.43E-13	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.83E-13	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	5.07E-12	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.53E-43	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	4.77E-11	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974	NA	1.54E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251