| Variant ID: vg1018561974 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18561974 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )
GGTGAATAGGCTAATTTAAAATTTTATGCGGAAGCTAAAACTAAAATAAGGTCGGAAAGTCTGATCCACAGTCAGATTATCCGAAAATATCAGATAGTCT[G/C]
ATGTCTGATCCACCAATGAAGCACAACAAGTAGATCTATAATACAAGCAAGAGTAAAGCACAAACAGTGACTAGATCTATAGCGGCACAATTAAGCAAAG
CTTTGCTTAATTGTGCCGCTATAGATCTAGTCACTGTTTGTGCTTTACTCTTGCTTGTATTATAGATCTACTTGTTGTGCTTCATTGGTGGATCAGACAT[C/G]
AGACTATCTGATATTTTCGGATAATCTGACTGTGGATCAGACTTTCCGACCTTATTTTAGTTTTAGCTTCCGCATAAAATTTTAAATTAGCCTATTCACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 30.40% | 3.96% | 0.87% | NA |
| All Indica | 2759 | 93.10% | 2.00% | 3.55% | 1.38% | NA |
| All Japonica | 1512 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 41.30% | 27.90% | 30.86% | 0.00% | NA |
| Indica I | 595 | 94.50% | 2.20% | 1.34% | 2.02% | NA |
| Indica II | 465 | 89.50% | 0.60% | 8.17% | 1.72% | NA |
| Indica III | 913 | 96.10% | 2.20% | 1.42% | 0.33% | NA |
| Indica Intermediate | 786 | 90.70% | 2.40% | 4.96% | 1.91% | NA |
| Temperate Japonica | 767 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 54.00% | 46.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 96.90% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 35.60% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018561974 | G -> C | LOC_Os10g34750.1 | upstream_gene_variant ; 2647.0bp to feature; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| vg1018561974 | G -> C | LOC_Os10g34760.1 | upstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| vg1018561974 | G -> C | LOC_Os10g34750.2 | upstream_gene_variant ; 2647.0bp to feature; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| vg1018561974 | G -> C | LOC_Os10g34770.1 | downstream_gene_variant ; 3024.0bp to feature; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| vg1018561974 | G -> C | LOC_Os10g34760-LOC_Os10g34770 | intergenic_region ; MODIFIER | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| vg1018561974 | G -> DEL | N | N | silent_mutation | Average:36.008; most accessible tissue: Callus, score: 64.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018561974 | NA | 2.68E-10 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 1.73E-11 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | 4.49E-06 | 2.47E-11 | mr1129 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 2.65E-13 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 9.32E-08 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 5.44E-12 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 2.81E-09 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 3.45E-13 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | NA | 7.90E-09 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018561974 | 9.38E-11 | 1.09E-54 | mr1771 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/