\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018561974:

Variant ID: vg1018561974 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18561974
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGAATAGGCTAATTTAAAATTTTATGCGGAAGCTAAAACTAAAATAAGGTCGGAAAGTCTGATCCACAGTCAGATTATCCGAAAATATCAGATAGTCT[G/C]
ATGTCTGATCCACCAATGAAGCACAACAAGTAGATCTATAATACAAGCAAGAGTAAAGCACAAACAGTGACTAGATCTATAGCGGCACAATTAAGCAAAG

Reverse complement sequence

CTTTGCTTAATTGTGCCGCTATAGATCTAGTCACTGTTTGTGCTTTACTCTTGCTTGTATTATAGATCTACTTGTTGTGCTTCATTGGTGGATCAGACAT[C/G]
AGACTATCTGATATTTTCGGATAATCTGACTGTGGATCAGACTTTCCGACCTTATTTTAGTTTTAGCTTCCGCATAAAATTTTAAATTAGCCTATTCACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 30.40% 3.96% 0.87% NA
All Indica  2759 93.10% 2.00% 3.55% 1.38% NA
All Japonica  1512 22.00% 78.00% 0.00% 0.00% NA
Aus  269 41.30% 27.90% 30.86% 0.00% NA
Indica I  595 94.50% 2.20% 1.34% 2.02% NA
Indica II  465 89.50% 0.60% 8.17% 1.72% NA
Indica III  913 96.10% 2.20% 1.42% 0.33% NA
Indica Intermediate  786 90.70% 2.40% 4.96% 1.91% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 54.00% 46.00% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 96.90% 3.12% 0.00% NA
Intermediate  90 57.80% 35.60% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018561974 G -> C LOC_Os10g34750.1 upstream_gene_variant ; 2647.0bp to feature; MODIFIER silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N
vg1018561974 G -> C LOC_Os10g34760.1 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N
vg1018561974 G -> C LOC_Os10g34750.2 upstream_gene_variant ; 2647.0bp to feature; MODIFIER silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N
vg1018561974 G -> C LOC_Os10g34770.1 downstream_gene_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N
vg1018561974 G -> C LOC_Os10g34760-LOC_Os10g34770 intergenic_region ; MODIFIER silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N
vg1018561974 G -> DEL N N silent_mutation Average:36.008; most accessible tissue: Callus, score: 64.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018561974 NA 2.68E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.73E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 4.49E-06 2.47E-11 mr1129 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 2.65E-13 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 9.32E-08 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 5.44E-12 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 2.81E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 3.45E-13 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 7.90E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 9.38E-11 1.09E-54 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 5.55E-08 6.99E-23 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 1.87E-07 3.46E-45 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 5.62E-07 8.52E-19 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 2.82E-11 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.19E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 4.85E-06 2.22E-29 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.89E-10 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 5.90E-15 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 6.57E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 9.73E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 3.13E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 5.41E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.06E-13 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 3.64E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 8.93E-06 4.04E-46 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 4.42E-13 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 2.42E-46 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 3.43E-13 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.83E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 5.07E-12 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.53E-43 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 4.77E-11 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018561974 NA 1.54E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251