\
| Variant ID: vg1018461662 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 18461662 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.37, others allele: 0.00, population size: 107. )
TGAAAGAGGTTAGCGGCGAAGTCAGCCCGAACACCCCCGACATTAGCTCGGAGGTCACCGAGGTAGAACGCGCCGTTGCCGACATTGAAACCACAGACGA[T/C]
TGGCGCATCCCACTAATCAAATTCATCAGCAGCGAGGAGTTGCCCAAGGACAATACAGAGGCCGAGAAAATAACCTGTAAAGCAAAGATCTACTGTATGG
CCATACAGTAGATCTTTGCTTTACAGGTTATTTTCTCGGCCTCTGTATTGTCCTTGGGCAACTCCTCGCTGCTGATGAATTTGATTAGTGGGATGCGCCA[A/G]
TCGTCTGTGGTTTCAATGTCGGCAACGGCGCGTTCTACCTCGGTGACCTCCGAGCTAATGTCGGGGGTGTTCGGGCTGACTTCGCCGCTAACCTCTTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 0.30% | 13.84% | 38.64% | NA |
| All Indica | 2759 | 30.60% | 0.10% | 11.74% | 57.59% | NA |
| All Japonica | 1512 | 84.70% | 0.20% | 3.37% | 11.71% | NA |
| Aus | 269 | 11.20% | 2.20% | 74.35% | 12.27% | NA |
| Indica I | 595 | 25.50% | 0.00% | 14.79% | 59.66% | NA |
| Indica II | 465 | 58.90% | 0.20% | 6.24% | 34.62% | NA |
| Indica III | 913 | 16.10% | 0.20% | 11.06% | 72.62% | NA |
| Indica Intermediate | 786 | 34.40% | 0.00% | 13.49% | 52.16% | NA |
| Temperate Japonica | 767 | 97.70% | 0.30% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 63.90% | 0.20% | 7.54% | 28.37% | NA |
| Japonica Intermediate | 241 | 87.10% | 0.00% | 5.39% | 7.47% | NA |
| VI/Aromatic | 96 | 33.30% | 1.00% | 65.62% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 2.20% | 17.78% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1018461662 | T -> C | LOC_Os10g34640.1 | synonymous_variant ; p.Asp543Asp; LOW | synonymous_codon | Average:25.255; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| vg1018461662 | T -> DEL | LOC_Os10g34640.1 | N | frameshift_variant | Average:25.255; most accessible tissue: Minghui63 root, score: 36.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1018461662 | NA | 1.50E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 4.00E-10 | mr1235 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 1.94E-07 | mr1243 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 2.00E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 3.31E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 1.05E-10 | mr1435 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 5.97E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 8.21E-09 | mr1599 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | 4.97E-06 | 4.97E-06 | mr1748 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | 3.18E-06 | 3.18E-06 | mr1783 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 4.16E-14 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 1.36E-06 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 7.74E-10 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1018461662 | NA | 1.97E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |