RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1018443385:

Variant ID: vg1018443385 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18443385
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGGAGGTATTTTGGTTTTTTATCTATCCCCTTATATTCATCTTGGGAAGCTAGGGTTGGACATTTTGTGGGATAGAGGGAGTAGTCATAAATACGAGC[A/G]
GGTGCCAAGTGTAGAACTTGAACTTAGATGAACATGTATCACCAGAAGTAACATAATGAGCTATGATATTTAATATTATCACAAAACAATCTTTGTTAAC

Reverse complement sequence

GTTAACAAAGATTGTTTTGTGATAATATTAAATATCATAGCTCATTATGTTACTTCTGGTGATACATGTTCATCTAAGTTCAAGTTCTACACTTGGCACC[T/C]
GCTCGTATTTATGACTACTCCCTCTATCCCACAAAATGTCCAACCCTAGCTTCCCAAGATGAATATAAGGGGATAGATAAAAAACCAAAATACCTCCAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.70%	0.15%	0.00%	NA
All Indica	2759	99.00%	1.00%	0.04%	0.00%	NA
All Japonica	1512	21.10%	78.60%	0.33%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.00%	2.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.40%	0.13%	0.00%	NA
Temperate Japonica	767	6.60%	93.00%	0.39%	0.00%	NA
Tropical Japonica	504	42.90%	57.10%	0.00%	0.00%	NA
Japonica Intermediate	241	21.60%	77.60%	0.83%	0.00%	NA
VI/Aromatic	96	69.80%	29.20%	1.04%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018443385	A -> G	LOC_Os10g34590.1	upstream_gene_variant ; 946.0bp to feature; MODIFIER	silent_mutation	Average:34.85; most accessible tissue: Callus, score: 59.592	N	N	N	N
vg1018443385	A -> G	LOC_Os10g34602.1	upstream_gene_variant ; 2686.0bp to feature; MODIFIER	silent_mutation	Average:34.85; most accessible tissue: Callus, score: 59.592	N	N	N	N
vg1018443385	A -> G	LOC_Os10g34590-LOC_Os10g34602	intergenic_region ; MODIFIER	silent_mutation	Average:34.85; most accessible tissue: Callus, score: 59.592	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018443385	NA	3.01E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	1.77E-44	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	2.89E-13	mr1093	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	3.74E-08	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	1.82E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	9.74E-11	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	6.01E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	1.04E-09	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	2.67E-07	mr1257	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018443385	NA	2.19E-88	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 42 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg1018443385:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact