Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018385481:

Variant ID: vg1018385481 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 18385481
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ATGATACATAAGTCAGTACAATCTTCTTCCTCTATCCTCCCCTCTTCTCTCTATCCTATCTTCATCTTGTTTTCAAATGTGACTGACAACGAGGAGGGCG[T/C]
TGGCAAGGGAGGAGGATGAGCGAAGGAGGCTGATGATGGCGGATTGCCGCTGATGGGAGGTCGACGGCTCCCGAGCTCTACCACCGCGGATGGGAGAAAG

Reverse complement sequence

CTTTCTCCCATCCGCGGTGGTAGAGCTCGGGAGCCGTCGACCTCCCATCAGCGGCAATCCGCCATCATCAGCCTCCTTCGCTCATCCTCCTCCCTTGCCA[A/G]
CGCCCTCCTCGTTGTCAGTCACATTTGAAAACAAGATGAAGATAGGATAGAGAGAAGAGGGGAGGATAGAGGAAGAAGATTGTACTGACTTATGTATCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	44.80%	0.02%	0.34%	NA
All Indica	2759	83.40%	16.20%	0.04%	0.40%	NA
All Japonica	1512	13.60%	86.40%	0.00%	0.00%	NA
Aus	269	17.50%	81.80%	0.00%	0.74%	NA
Indica I	595	97.00%	2.70%	0.00%	0.34%	NA
Indica II	465	49.20%	50.10%	0.00%	0.65%	NA
Indica III	913	96.30%	3.50%	0.11%	0.11%	NA
Indica Intermediate	786	78.40%	21.00%	0.00%	0.64%	NA
Temperate Japonica	767	2.60%	97.40%	0.00%	0.00%	NA
Tropical Japonica	504	33.30%	66.70%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	0.00%	1.04%	NA
Intermediate	90	42.20%	55.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1018385481	T -> C	LOC_Os10g34450.1	upstream_gene_variant ; 2183.0bp to feature; MODIFIER	silent_mutation	Average:62.502; most accessible tissue: Callus, score: 76.012	N	N	N	N
vg1018385481	T -> C	LOC_Os10g34470.1	upstream_gene_variant ; 1061.0bp to feature; MODIFIER	silent_mutation	Average:62.502; most accessible tissue: Callus, score: 76.012	N	N	N	N
vg1018385481	T -> C	LOC_Os10g34480.1	downstream_gene_variant ; 4496.0bp to feature; MODIFIER	silent_mutation	Average:62.502; most accessible tissue: Callus, score: 76.012	N	N	N	N
vg1018385481	T -> C	LOC_Os10g34450-LOC_Os10g34470	intergenic_region ; MODIFIER	silent_mutation	Average:62.502; most accessible tissue: Callus, score: 76.012	N	N	N	N
vg1018385481	T -> DEL	N	N	silent_mutation	Average:62.502; most accessible tissue: Callus, score: 76.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1018385481	NA	5.22E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	2.09E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	8.49E-09	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	1.58E-08	8.72E-28	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	1.89E-09	mr1862	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	1.42E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	6.01E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	8.76E-13	mr1050_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	3.14E-07	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	1.62E-08	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	6.19E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	5.43E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	5.37E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	9.36E-11	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	2.79E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	1.11E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481	NA	4.11E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251