\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1018385481:

Variant ID: vg1018385481 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 18385481
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATACATAAGTCAGTACAATCTTCTTCCTCTATCCTCCCCTCTTCTCTCTATCCTATCTTCATCTTGTTTTCAAATGTGACTGACAACGAGGAGGGCG[T/C]
TGGCAAGGGAGGAGGATGAGCGAAGGAGGCTGATGATGGCGGATTGCCGCTGATGGGAGGTCGACGGCTCCCGAGCTCTACCACCGCGGATGGGAGAAAG

Reverse complement sequence

CTTTCTCCCATCCGCGGTGGTAGAGCTCGGGAGCCGTCGACCTCCCATCAGCGGCAATCCGCCATCATCAGCCTCCTTCGCTCATCCTCCTCCCTTGCCA[A/G]
CGCCCTCCTCGTTGTCAGTCACATTTGAAAACAAGATGAAGATAGGATAGAGAGAAGAGGGGAGGATAGAGGAAGAAGATTGTACTGACTTATGTATCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 44.80% 0.02% 0.34% NA
All Indica  2759 83.40% 16.20% 0.04% 0.40% NA
All Japonica  1512 13.60% 86.40% 0.00% 0.00% NA
Aus  269 17.50% 81.80% 0.00% 0.74% NA
Indica I  595 97.00% 2.70% 0.00% 0.34% NA
Indica II  465 49.20% 50.10% 0.00% 0.65% NA
Indica III  913 96.30% 3.50% 0.11% 0.11% NA
Indica Intermediate  786 78.40% 21.00% 0.00% 0.64% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 33.30% 66.70% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 0.00% 1.04% NA
Intermediate  90 42.20% 55.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1018385481 T -> C LOC_Os10g34450.1 upstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:62.502; most accessible tissue: Callus, score: 76.012 N N N N
vg1018385481 T -> C LOC_Os10g34470.1 upstream_gene_variant ; 1061.0bp to feature; MODIFIER silent_mutation Average:62.502; most accessible tissue: Callus, score: 76.012 N N N N
vg1018385481 T -> C LOC_Os10g34480.1 downstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:62.502; most accessible tissue: Callus, score: 76.012 N N N N
vg1018385481 T -> C LOC_Os10g34450-LOC_Os10g34470 intergenic_region ; MODIFIER silent_mutation Average:62.502; most accessible tissue: Callus, score: 76.012 N N N N
vg1018385481 T -> DEL N N silent_mutation Average:62.502; most accessible tissue: Callus, score: 76.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1018385481 NA 5.22E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 2.09E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 8.49E-09 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 1.58E-08 8.72E-28 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 1.89E-09 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 1.42E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 6.01E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 8.76E-13 mr1050_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 3.14E-07 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 1.62E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 6.19E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 5.43E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 5.37E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 9.36E-11 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 2.79E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 1.11E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1018385481 NA 4.11E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251