Variant ID: vg1018035120 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 18035120 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTTCATCACTTGGATTGACGTTTAATTATAATAAGAAAGTACCCAACTGTCCTTGTTCTATTGGCTAATCGGAGACTATATCTTTGCAGGCTAAGCCGC[C/T]
GCAGTAACCGCATGCACTCAATAGGTAACTATCGTCTTATAATGTACTCCCTCTCTAAAATAAACAAAATTCTAGAAATGTTATAATCAAGTTTTTCTAA
TTAGAAAAACTTGATTATAACATTTCTAGAATTTTGTTTATTTTAGAGAGGGAGTACATTATAAGACGATAGTTACCTATTGAGTGCATGCGGTTACTGC[G/A]
GCGGCTTAGCCTGCAAAGATATAGTCTCCGATTAGCCAATAGAACAAGGACAGTTGGGTACTTTCTTATTATAATTAAACGTCAATCCAAGTGATGAAGA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 99.40% | 0.40% | 0.15% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 98.20% | 1.30% | 0.46% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.30% | 2.00% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1018035120 | C -> T | LOC_Os10g33930.1 | upstream_gene_variant ; 1427.0bp to feature; MODIFIER | silent_mutation | Average:40.501; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
vg1018035120 | C -> T | LOC_Os10g33920-LOC_Os10g33930 | intergenic_region ; MODIFIER | silent_mutation | Average:40.501; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1018035120 | 4.82E-07 | 1.88E-07 | mr1240 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1018035120 | NA | 2.37E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |