| Variant ID: vg1017997693 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17997693 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCAAATTCGTTTTATTAAATATAACATTGGAACCTATATATTTTGATAAAATATAAAAAAATGAATATGAAAATTAAAACAAAATTGCTATATTTTTCTA[C/T]
AAATTTAATCGAACCTAGAAAAAATTTAACTAGTAAAAATAATCAAAACGATCTATAATAACAAAGAGACATAGAACAACCTAGTTCAGGACCAATGTAC
GTACATTGGTCCTGAACTAGGTTGTTCTATGTCTCTTTGTTATTATAGATCGTTTTGATTATTTTTACTAGTTAAATTTTTTCTAGGTTCGATTAAATTT[G/A]
TAGAAAAATATAGCAATTTTGTTTTAATTTTCATATTCATTTTTTTATATTTTATCAAAATATATAGGTTCCAATGTTATATTTAATAAAACGAATTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 4.60% | 1.04% | 1.67% | NA |
| All Indica | 2759 | 97.10% | 0.00% | 1.12% | 1.78% | NA |
| All Japonica | 1512 | 83.10% | 14.00% | 1.19% | 1.72% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 0.00% | 1.85% | 1.51% | NA |
| Indica II | 465 | 91.60% | 0.00% | 2.80% | 5.59% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 97.60% | 0.00% | 0.89% | 1.53% | NA |
| Temperate Japonica | 767 | 93.90% | 0.50% | 2.22% | 3.39% | NA |
| Tropical Japonica | 504 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 9.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 3.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017997693 | C -> T | LOC_Os10g33900.1 | upstream_gene_variant ; 3160.0bp to feature; MODIFIER | silent_mutation | Average:58.977; most accessible tissue: Callus, score: 80.373 | N | N | N | N |
| vg1017997693 | C -> T | LOC_Os10g33886-LOC_Os10g33900 | intergenic_region ; MODIFIER | silent_mutation | Average:58.977; most accessible tissue: Callus, score: 80.373 | N | N | N | N |
| vg1017997693 | C -> DEL | N | N | silent_mutation | Average:58.977; most accessible tissue: Callus, score: 80.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017997693 | 1.48E-08 | 5.55E-08 | mr1076 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | NA | 1.56E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | 2.00E-06 | 8.65E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | 3.60E-07 | 3.60E-07 | mr1204 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | 7.07E-06 | 7.53E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | 4.10E-07 | 2.32E-08 | mr1408 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | 2.71E-06 | 1.83E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | NA | 8.25E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017997693 | NA | 5.11E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |