Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017959818:

Variant ID: vg1017959818 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17959818
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTGCTAAACGCTACGGTGCAACTCTATTTGTCTATAATAATTTTTAAAATTTTCATGTTTCGTAAAAAAAATATTATTATATGAACTGTGCATTTGAG[T/C]
TTTAATTCAATTTATGTCATGCATCAAATATATTGCAAGTAAAATATAATAATAGGATATACCAATATATTTATACCCCATGTCATAATGCATAATAATA

Reverse complement sequence

TATTATTATGCATTATGACATGGGGTATAAATATATTGGTATATCCTATTATTATATTTTACTTGCAATATATTTGATGCATGACATAAATTGAATTAAA[A/G]
CTCAAATGCACAGTTCATATAATAATATTTTTTTTACGAAACATGAAAATTTTAAAAATTATTATAGACAAATAGAGTTGCACCGTAGCGTTTAGCACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.70% 0.02% 0.00% NA
All Indica  2759 96.80% 3.10% 0.04% 0.00% NA
All Japonica  1512 22.70% 77.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 89.00% 10.80% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017959818 T -> C LOC_Os10g33830.1 upstream_gene_variant ; 2892.0bp to feature; MODIFIER silent_mutation Average:59.377; most accessible tissue: Callus, score: 81.091 N N N N
vg1017959818 T -> C LOC_Os10g33840.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:59.377; most accessible tissue: Callus, score: 81.091 N N N N
vg1017959818 T -> C LOC_Os10g33840.3 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:59.377; most accessible tissue: Callus, score: 81.091 N N N N
vg1017959818 T -> C LOC_Os10g33840.2 downstream_gene_variant ; 657.0bp to feature; MODIFIER silent_mutation Average:59.377; most accessible tissue: Callus, score: 81.091 N N N N
vg1017959818 T -> C LOC_Os10g33830-LOC_Os10g33840 intergenic_region ; MODIFIER silent_mutation Average:59.377; most accessible tissue: Callus, score: 81.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017959818 6.37E-06 6.37E-06 mr1929 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 9.91E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 7.74E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.32E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.89E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 7.40E-34 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.12E-28 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.33E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.91E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 7.35E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 7.69E-07 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.10E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.73E-26 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 8.84E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.09E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 9.80E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.36E-13 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.20E-36 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.18E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.61E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 6.04E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.73E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.00E-21 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.92E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 8.43E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.27E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 5.48E-15 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.84E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.76E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.27E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 1.11E-06 NA mr1751_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 6.82E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.56E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 1.52E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.02E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.76E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 2.48E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 3.48E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 8.17E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 7.44E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017959818 NA 4.80E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251