\
| Variant ID: vg1017951405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17951405 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )
AAAGCGGTGGAATTGAGATAATATGTTCAATACTGCTCCAAATTCAGGAAATTACCTTTGACTACAAGAAAATTTCCCTTCGAATGGTTGTACATTGACA[G/A]
CACGAACACTGCATTCATGGTGTAATCTGGCTTAAAGCTTAGTCGGGACAGCACAAGAGAAAGAGCAACATGTGGAGTTCCATCACCAAGGGTTTTATGC
GCATAAAACCCTTGGTGATGGAACTCCACATGTTGCTCTTTCTCTTGTGCTGTCCCGACTAAGCTTTAAGCCAGATTACACCATGAATGCAGTGTTCGTG[C/T]
TGTCAATGTACAACCATTCGAAGGGAAATTTTCTTGTAGTCAAAGGTAATTTCCTGAATTTGGAGCAGTATTGAACATATTATCTCAATTCCACCGCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 2.60% | 3.98% | 3.28% | NA |
| All Indica | 2759 | 98.10% | 0.00% | 1.09% | 0.83% | NA |
| All Japonica | 1512 | 90.80% | 8.20% | 0.93% | 0.07% | NA |
| Aus | 269 | 6.30% | 0.00% | 47.96% | 45.72% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.65% | 0.43% | NA |
| Indica III | 913 | 97.70% | 0.00% | 1.31% | 0.99% | NA |
| Indica Intermediate | 786 | 96.60% | 0.00% | 1.91% | 1.53% | NA |
| Temperate Japonica | 767 | 84.00% | 14.70% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 14.58% | 7.29% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017951405 | G -> A | LOC_Os10g33830.1 | synonymous_variant ; p.Leu209Leu; LOW | synonymous_codon | Average:36.155; most accessible tissue: Callus, score: 51.315 | N | N | N | N |
| vg1017951405 | G -> DEL | LOC_Os10g33830.1 | N | frameshift_variant | Average:36.155; most accessible tissue: Callus, score: 51.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017951405 | NA | 4.28E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 9.20E-07 | 9.19E-07 | mr1346 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 2.33E-06 | 1.27E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 5.97E-06 | mr1428 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 2.01E-06 | 2.01E-06 | mr1456 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 4.37E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 4.85E-06 | 4.85E-06 | mr1577 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 2.35E-06 | 1.25E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 1.83E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 3.14E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | 7.67E-07 | 2.13E-08 | mr1780 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 1.90E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017951405 | NA | 6.19E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |