\
| Variant ID: vg1017949223 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17949223 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.33, others allele: 0.00, population size: 254. )
GGATCAGTGTACCTTAATCCACTCAATGAAAAGGATTTTCTTTTACCAAGAGATCATAATGGCATCAGATAACCAAATTAAGAAAGCACCATTTTTTGTC[A/G]
TCTGCGAGAAAGACAATGTACATACCTAGCAAACAGCCAGATCGCCCTCGCAGTCGCCGCCCAAACAAACACACACGAACTCGTCGCGTTTATCTCAACT
AGTTGAGATAAACGCGACGAGTTCGTGTGTGTTTGTTTGGGCGGCGACTGCGAGGGCGATCTGGCTGTTTGCTAGGTATGTACATTGTCTTTCTCGCAGA[T/C]
GACAAAAAATGGTGCTTTCTTAATTTGGTTATCTGATGCCATTATGATCTCTTGGTAAAAGAAAATCCTTTTCATTGAGTGGATTAAGGTACACTGATCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 37.70% | 0.06% | 0.28% | NA |
| All Indica | 2759 | 91.10% | 8.50% | 0.07% | 0.29% | NA |
| All Japonica | 1512 | 23.20% | 76.50% | 0.00% | 0.33% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.50% | 12.50% | 0.22% | 0.86% | NA |
| Indica III | 913 | 92.10% | 7.70% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 89.40% | 10.20% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 2.60% | 97.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 42.70% | 57.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 48.10% | 51.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017949223 | A -> G | LOC_Os10g33830.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.882; most accessible tissue: Callus, score: 93.384 | N | N | N | N |
| vg1017949223 | A -> DEL | N | N | silent_mutation | Average:62.882; most accessible tissue: Callus, score: 93.384 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017949223 | NA | 1.02E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 2.94E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 2.31E-11 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | 6.37E-06 | 6.37E-06 | mr1929 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 1.13E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 9.56E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 3.15E-16 | mr1147_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 7.69E-07 | mr1222_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 3.17E-27 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 1.36E-23 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 5.55E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 8.85E-12 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 1.13E-15 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 6.82E-06 | mr1751_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 4.02E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 2.21E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017949223 | NA | 7.44E-06 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |