Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017929024:

Variant ID: vg1017929024 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17929024
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCCATACATGCATGGATATATATTTTTAAAGGAAGAAAAAGGCGAAGAAAGATAACAAAAAGAATTTGTTTTCCATGATACCCGGATGCTAGCAGTA[G/A]
TATACAACAACTTGGTCCTTTTGTGAGAGTCTGGCTGCAGACATGTTGTTACTGAATTAACAAATTAAATATTGTAAAAGGTACACCCATATGCACCTAT

Reverse complement sequence

ATAGGTGCATATGGGTGTACCTTTTACAATATTTAATTTGTTAATTCAGTAACAACATGTCTGCAGCCAGACTCTCACAAAAGGACCAAGTTGTTGTATA[C/T]
TACTGCTAGCATCCGGGTATCATGGAAAACAAATTCTTTTTGTTATCTTTCTTCGCCTTTTTCTTCCTTTAAAAATATATATCCATGCATGTATGGCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 2.40% 0.74% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.10% 7.50% 2.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 82.70% 13.40% 3.91% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.79% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017929024 G -> A LOC_Os10g33810.1 upstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:78.012; most accessible tissue: Minghui63 root, score: 96.896 N N N N
vg1017929024 G -> A LOC_Os10g33810-LOC_Os10g33820 intergenic_region ; MODIFIER silent_mutation Average:78.012; most accessible tissue: Minghui63 root, score: 96.896 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017929024 G A -0.24 -0.08 -0.07 -0.04 -0.11 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017929024 NA 9.20E-06 mr1126 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 6.46E-06 6.46E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 6.73E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 3.83E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 4.07E-07 4.07E-07 mr1346 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 1.35E-06 4.16E-07 mr1379 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 8.29E-08 8.29E-08 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 2.73E-06 2.73E-06 mr1456 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 8.73E-06 2.58E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 5.87E-06 5.87E-06 mr1577 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 4.10E-07 8.02E-12 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 4.37E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 3.13E-07 6.51E-11 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 9.10E-07 1.17E-08 mr1780 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 1.28E-06 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 2.18E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 NA 1.19E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017929024 3.80E-06 1.74E-09 mr1765_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251