Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017856339:

Variant ID: vg1017856339 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17856339
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GATCCCAACTTCACGATGGATTTTTGGCTGAATCATTTTTTTTCTTTTCTAGTTTGATTCACTTGTGAGTAATTTTATCACTCGTGTGTGATTGAGCCTG[C/T]
ATTTTTTTTCATTCGTATGACCATTTTATAATACAGATTAACAATACTCTTAGTATCAATTTTTACTCTTATATTGTGTATTGAACATATCAGTAAACAG

Reverse complement sequence

CTGTTTACTGATATGTTCAATACACAATATAAGAGTAAAAATTGATACTAAGAGTATTGTTAATCTGTATTATAAAATGGTCATACGAATGAAAAAAAAT[G/A]
CAGGCTCAATCACACACGAGTGATAAAATTACTCACAAGTGAATCAAACTAGAAAAGAAAAAAAATGATTCAGCCAAAAATCCATCGTGAAGTTGGGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.20%	15.70%	1.08%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	50.00%	46.90%	3.11%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	11.20%	85.10%	3.65%	0.00%	NA
Tropical Japonica	504	97.40%	1.40%	1.19%	0.00%	NA
Japonica Intermediate	241	74.30%	20.30%	5.39%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017856339	C -> T	LOC_Os10g33770.1	upstream_gene_variant ; 1870.0bp to feature; MODIFIER	silent_mutation	Average:49.594; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1017856339	C -> T	LOC_Os10g33760.1	downstream_gene_variant ; 4942.0bp to feature; MODIFIER	silent_mutation	Average:49.594; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1017856339	C -> T	LOC_Os10g33760-LOC_Os10g33770	intergenic_region ; MODIFIER	silent_mutation	Average:49.594; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017856339	NA	4.00E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	3.01E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	2.57E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	2.20E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	1.11E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	4.98E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	4.46E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	5.33E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	1.24E-37	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	4.36E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	4.73E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	8.82E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	2.45E-08	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	5.75E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	7.65E-31	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	2.45E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	3.44E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	6.18E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	1.74E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	7.32E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	7.72E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	4.80E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	4.62E-06	NA	mr1793_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017856339	NA	1.93E-08	mr1793_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251