RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1017847198:

Variant ID: vg1017847198 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17847198
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, A: 0.20, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TATCACTAATGGTTGATTGCTTCCCCAGTGAGATCTCAAACAGCCCGATTTTTTTAAAAAAAAATGAGATATCGGTGAGAGTTTTTATATTTTAGAATGG[T/A]
CACGAAAAGTTGTTACTATATTATTCTGGAACGGAGGGACTACATGTAGTGCCACCAGGGGATCGAGCACAAATTAAGGTGACCAGCCAGCATGCAAGGA

Reverse complement sequence

TCCTTGCATGCTGGCTGGTCACCTTAATTTGTGCTCGATCCCCTGGTGGCACTACATGTAGTCCCTCCGTTCCAGAATAATATAGTAACAACTTTTCGTG[A/T]
CCATTCTAAAATATAAAAACTCTCACCGATATCTCATTTTTTTTTAAAAAAATCGGGCTGTTTGAGATCTCACTGGGGAAGCAATCAACCATTAGTGATA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	33.30%	0.13%	0.32%	NA
All Indica	2759	96.10%	3.50%	0.07%	0.33%	NA
All Japonica	1512	9.50%	90.10%	0.13%	0.26%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.30%	2.00%	0.17%	0.50%	NA
Indica II	465	88.40%	11.20%	0.00%	0.43%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	95.90%	3.40%	0.13%	0.51%	NA
Temperate Japonica	767	1.70%	97.90%	0.26%	0.13%	NA
Tropical Japonica	504	8.30%	91.30%	0.00%	0.40%	NA
Japonica Intermediate	241	36.90%	62.70%	0.00%	0.41%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	56.70%	38.90%	2.22%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017847198	T -> A	LOC_Os10g33760.1	upstream_gene_variant ; 1890.0bp to feature; MODIFIER	silent_mutation	Average:57.941; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg1017847198	T -> A	LOC_Os10g33750-LOC_Os10g33760	intergenic_region ; MODIFIER	silent_mutation	Average:57.941; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg1017847198	T -> DEL	N	N	silent_mutation	Average:57.941; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017847198	6.17E-06	8.83E-21	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	6.46E-06	6.00E-19	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	NA	3.69E-07	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	NA	6.96E-29	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	2.49E-07	6.54E-22	mr1022	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	NA	1.93E-15	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	4.01E-07	3.19E-23	mr1055	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	NA	3.22E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	9.98E-07	3.08E-21	mr1079	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017847198	NA	2.20E-09	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 63 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg1017847198:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact