Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017749017:

Variant ID: vg1017749017 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17749017
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAATGCAAAACAAATTCTCAGATGAATCTGAACACACAAGACTATTTACAAACTAGCAAATATTCTAGGCATTTTTTCTCATTAGTTAGACAACTTAA[G/T]
GGGTGTGGCTACAGATGCATACCTCTAGCTGCAACGTTCCAATATCTCTCTCAATACCTTCAGATGAAATGCCAACAAATTAGATTCTCCAGAAACGAGA

Reverse complement sequence

TCTCGTTTCTGGAGAATCTAATTTGTTGGCATTTCATCTGAAGGTATTGAGAGAGATATTGGAACGTTGCAGCTAGAGGTATGCATCTGTAGCCACACCC[C/A]
TTAAGTTGTCTAACTAATGAGAAAAAATGCCTAGAATATTTGCTAGTTTGTAAATAGTCTTGTGTGTTCAGATTCATCTGAGAATTTGTTTTGCATTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	7.80%	4.17%	0.00%	NA
All Indica	2759	80.00%	13.10%	6.89%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	55.10%	24.00%	20.84%	0.00%	NA
Indica II	465	94.40%	3.00%	2.58%	0.00%	NA
Indica III	913	89.30%	9.90%	0.88%	0.00%	NA
Indica Intermediate	786	79.60%	14.50%	5.85%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	5.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017749017	G -> T	LOC_Os10g33650.1	downstream_gene_variant ; 4450.0bp to feature; MODIFIER	silent_mutation	Average:60.752; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1017749017	G -> T	LOC_Os10g33670.1	downstream_gene_variant ; 2607.0bp to feature; MODIFIER	silent_mutation	Average:60.752; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1017749017	G -> T	LOC_Os10g33650.2	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:60.752; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1017749017	G -> T	LOC_Os10g33650.3	downstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:60.752; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N
vg1017749017	G -> T	LOC_Os10g33660.1	intron_variant ; MODIFIER	silent_mutation	Average:60.752; most accessible tissue: Minghui63 flower, score: 76.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017749017	NA	7.92E-14	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017749017	NA	6.01E-12	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017749017	NA	3.74E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	1.69E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	2.67E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	2.11E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	4.43E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	2.28E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	1.78E-10	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	8.88E-08	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	3.34E-07	mr1348_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	1.52E-09	mr1539_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	4.30E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	5.12E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	3.23E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	8.01E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	4.73E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017749017	NA	5.49E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251