\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017720440:

Variant ID: vg1017720440 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17720440
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAGGATCTCGGCGATGCGGCGACAGTTCTCCTCCCCGGCGCCAACGATATTCCCGACCAGCGAAGGGACGTCGACATCGTCCGTGGCGGCGAAGCTG[C/T]
AGAGGAAGAGAGGCAGCGGGTGGGTGCGCATGGGGAGGCAGCCAAGGAGCGGCATGGGCGGAGCTGGTCAGAGGATGGCTAGCTTAATGTCCCCACTGCG

Reverse complement sequence

CGCAGTGGGGACATTAAGCTAGCCATCCTCTGACCAGCTCCGCCCATGCCGCTCCTTGGCTGCCTCCCCATGCGCACCCACCCGCTGCCTCTCTTCCTCT[G/A]
CAGCTTCGCCGCCACGGACGATGTCGACGTCCCTTCGCTGGTCGGGAATATCGTTGGCGCCGGGGAGGAGAACTGTCGCCGCATCGCCGAGATCCTCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.20% 0.13% 0.44% NA
All Indica  2759 96.40% 3.00% 0.07% 0.54% NA
All Japonica  1512 9.50% 90.10% 0.13% 0.26% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 98.50% 0.50% 0.00% 1.01% NA
Indica II  465 88.00% 11.00% 0.00% 1.08% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.40% 0.25% 0.51% NA
Temperate Japonica  767 1.80% 97.80% 0.26% 0.13% NA
Tropical Japonica  504 8.10% 91.50% 0.00% 0.40% NA
Japonica Intermediate  241 36.90% 62.70% 0.00% 0.41% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 52.20% 43.30% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017720440 C -> T LOC_Os10g33610.1 missense_variant ; p.Ala72Val; MODERATE nonsynonymous_codon ; A72V Average:68.606; most accessible tissue: Minghui63 panicle, score: 83.421 benign 1.126 TOLERATED 0.17
vg1017720440 C -> DEL LOC_Os10g33610.1 N frameshift_variant Average:68.606; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017720440 NA 6.87E-28 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.36E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 6.11E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 7.42E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.29E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 7.16E-06 7.16E-06 mr1141 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 4.82E-06 3.44E-07 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 5.81E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 1.16E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 1.66E-06 5.24E-06 mr1404 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 9.73E-06 NA mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 5.27E-07 2.34E-35 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 5.27E-06 3.11E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 3.85E-06 1.39E-07 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 1.65E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 5.24E-41 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 1.59E-06 NA mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 9.66E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 6.09E-08 2.90E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 6.19E-34 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.11E-36 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.11E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 3.00E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 6.93E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 6.72E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.44E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 9.52E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 2.48E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017720440 NA 7.54E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251