Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017718456:

Variant ID: vg1017718456 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 17718456
Reference Allele: C	Alternative Allele: A,CA
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.11, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAATGGATGTGTGGTTTCAACCTTAAGATAATGTGTTCAATTCTTCACACGCTGGTTTTACGTATTGTAAAAAGAGAAAATTCAAGAAATGCCATTAA[C/A,CA]
AAATATCCAATTATAAGAAATGTCATCAACAAGTGTGAGTTCTATCGTCGTTAGGGTTCTGTTAGCAGCTCTCCATTAAGTGCTATAGGATGAACAATTC

Reverse complement sequence

GAATTGTTCATCCTATAGCACTTAATGGAGAGCTGCTAACAGAACCCTAACGACGATAGAACTCACACTTGTTGATGACATTTCTTATAATTGGATATTT[G/T,TG]
TTAATGGCATTTCTTGAATTTTCTCTTTTTACAATACGTAAAACCAGCGTGTGAAGAATTGAACACATTATCTTAAGGTTGAAACCACACATCCATTACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	33.20%	0.21%	0.30%	CA: 0.02%
All Indica	2759	96.50%	2.90%	0.14%	0.43%	NA
All Japonica	1512	9.60%	90.00%	0.33%	0.00%	CA: 0.07%
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	98.70%	0.30%	0.00%	1.01%	NA
Indica II	465	88.00%	11.00%	0.65%	0.43%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.30%	0.13%	0.51%	NA
Temperate Japonica	767	2.00%	97.90%	0.13%	0.00%	NA
Tropical Japonica	504	8.10%	91.10%	0.60%	0.00%	CA: 0.20%
Japonica Intermediate	241	36.90%	62.70%	0.41%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017718456	C -> CA	LOC_Os10g33600.1	upstream_gene_variant ; 1913.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> CA	LOC_Os10g33610.1	upstream_gene_variant ; 1769.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> CA	LOC_Os10g33620.1	upstream_gene_variant ; 4010.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> CA	LOC_Os10g33600-LOC_Os10g33610	intergenic_region ; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> A	LOC_Os10g33600.1	upstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> A	LOC_Os10g33610.1	upstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> A	LOC_Os10g33620.1	upstream_gene_variant ; 4011.0bp to feature; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> A	LOC_Os10g33600-LOC_Os10g33610	intergenic_region ; MODIFIER	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N
vg1017718456	C -> DEL	N	N	silent_mutation	Average:43.319; most accessible tissue: Callus, score: 70.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017718456	NA	4.98E-14	mr1016	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.85E-12	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.02E-14	mr1022	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.83E-11	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.78E-15	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	5.47E-14	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.57E-12	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.12E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	1.96E-06	NA	mr1265	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.18E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	3.81E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	5.55E-12	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.23E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.39E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.23E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.67E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	3.76E-13	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.28E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.51E-32	mr1546	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.59E-11	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.04E-14	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.02E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.44E-16	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.25E-10	mr1023_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	6.75E-15	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.93E-13	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.36E-33	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	7.71E-14	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.54E-16	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.11E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.88E-26	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	6.20E-15	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.04E-25	mr1403_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.14E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.47E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	9.98E-09	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	2.30E-13	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	1.95E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	5.03E-11	mr1546_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	4.47E-20	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	3.55E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017718456	NA	9.43E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251