\
| Variant ID: vg1017701795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17701795 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 109. )
GACAGCGATGCAATGCTTCTATGTTTCACGGGGCAAACGAAGTGAACCACCTCTTTCTCCTGAGGAAGAGGCTAAGTTCGAGGCTTCGGATTGCCTGTTC[T/C]
GTGGAGCATTGATCAGTGTACTCGCTGACAACATAGTGGACGTGTACATGCACATGCCTTCCGAGAAGGACATGTGGGATGCACTTGAGGCCAAGTTCGG
CCGAACTTGGCCTCAAGTGCATCCCACATGTCCTTCTCGGAAGGCATGTGCATGTACACGTCCACTATGTTGTCAGCGAGTACACTGATCAATGCTCCAC[A/G]
GAACAGGCAATCCGAAGCCTCGAACTTAGCCTCTTCCTCAGGAGAAAGAGGTGGTTCACTTCGTTTGCCCCGTGAAACATAGAAGCATTGCATCGCTGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 32.10% | 0.40% | 0.04% | NA |
| All Indica | 2759 | 96.60% | 2.90% | 0.47% | 0.04% | NA |
| All Japonica | 1512 | 12.80% | 86.90% | 0.26% | 0.07% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.34% | 0.17% | NA |
| Indica II | 465 | 88.20% | 11.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 97.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 17.50% | 82.10% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 37.30% | 62.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017701795 | T -> C | LOC_Os10g33570.1 | missense_variant ; p.Cys190Arg; MODERATE | nonsynonymous_codon ; C190R | Average:34.091; most accessible tissue: Minghui63 flower, score: 55.591 | benign |
-0.512 |
TOLERATED | 0.78 |
| vg1017701795 | T -> DEL | LOC_Os10g33570.1 | N | frameshift_variant | Average:34.091; most accessible tissue: Minghui63 flower, score: 55.591 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017701795 | NA | 5.76E-10 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 3.30E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 1.86E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 1.29E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 1.13E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 7.24E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | 3.88E-06 | NA | mr1622_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 2.59E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 1.09E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701795 | NA | 6.73E-08 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |