\
| Variant ID: vg1017701671 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17701671 |
| Reference Allele: T | Alternative Allele: G,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.09, others allele: 0.00, population size: 236. )
TATTTCCAACAATCCAAAAACCTGATAAGTCATTTTCGGTAGTTGGCTTTGATGCTGCACTGAAACCACATGCTTTTGATGGTTCTAACTATAAGAGATG[T/G,A]
AAAGCACGTGCACTATTGTGGTTGACAGCGATGCAATGCTTCTATGTTTCACGGGGCAAACGAAGTGAACCACCTCTTTCTCCTGAGGAAGAGGCTAAGT
ACTTAGCCTCTTCCTCAGGAGAAAGAGGTGGTTCACTTCGTTTGCCCCGTGAAACATAGAAGCATTGCATCGCTGTCAACCACAATAGTGCACGTGCTTT[A/C,T]
CATCTCTTATAGTTAGAACCATCAAAAGCATGTGGTTTCAGTGCAGCATCAAAGCCAACTACCGAAAATGACTTATCAGGTTTTTGGATTGTTGGAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 33.10% | 0.17% | 0.00% | A: 0.02% |
| All Indica | 2759 | 95.60% | 4.20% | 0.14% | 0.00% | A: 0.04% |
| All Japonica | 1512 | 12.60% | 87.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.11% | 0.00% | A: 0.11% |
| Indica Intermediate | 786 | 94.70% | 5.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.10% | 82.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017701671 | T -> G | LOC_Os10g33570.1 | missense_variant ; p.Cys148Trp; MODERATE | nonsynonymous_codon ; C148W | Average:40.295; most accessible tissue: Zhenshan97 flower, score: 51.467 | probably damaging |
-3.083 |
TOLERATED | 1.00 |
| vg1017701671 | T -> A | LOC_Os10g33570.1 | stop_gained ; p.Cys148*; HIGH | stop_gained | Average:40.295; most accessible tissue: Zhenshan97 flower, score: 51.467 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017701671 | NA | 1.27E-44 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | 2.50E-06 | 3.52E-23 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 8.82E-20 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.28E-08 | mr1018 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.16E-29 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.32E-22 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 7.34E-19 | mr1023 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | 6.99E-06 | 5.70E-24 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.31E-22 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 6.34E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 7.11E-10 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 7.96E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 6.64E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 6.77E-19 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | 3.58E-06 | 3.03E-21 | mr1142 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.99E-19 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.47E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 6.06E-08 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.55E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.51E-11 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 8.40E-20 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.39E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 5.95E-09 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.84E-07 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 7.83E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.75E-13 | mr1489 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.01E-18 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | 6.10E-06 | 1.06E-20 | mr1491 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.45E-33 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.06E-16 | mr1546 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.17E-08 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.54E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.26E-06 | mr1805 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.11E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.09E-21 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.18E-14 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.10E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.02E-21 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 8.76E-07 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.98E-18 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.80E-32 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.34E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.45E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.95E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 7.43E-19 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.25E-22 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 6.61E-11 | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.16E-18 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.00E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.63E-10 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.00E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.77E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.42E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.40E-20 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.44E-25 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.82E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.22E-10 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.86E-17 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.94E-12 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 3.34E-36 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.11E-13 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 5.59E-17 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.08E-07 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.92E-09 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 4.71E-21 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.88E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 5.89E-36 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.99E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 1.50E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 2.19E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.46E-08 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017701671 | NA | 9.48E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |