Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017593628:

Variant ID: vg1017593628 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17593628
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCAAAAGGATGCCTTTTCCTTTTATTTGCTCTACGCTTCGAAAAATTAATTAATATATTTCCTAGAAGAAAAGGTAGCTCATTATTTACACCTCTTAT[C/T]
TAAAATTATGTTTATTTCTTAAAATATTTAATTTATTCATATAATAGGTAGAAATCCACACCAATAATCTAAAATAAACATGATGTTAAGTCACCAATGA

Reverse complement sequence

TCATTGGTGACTTAACATCATGTTTATTTTAGATTATTGGTGTGGATTTCTACCTATTATATGAATAAATTAAATATTTTAAGAAATAAACATAATTTTA[G/A]
ATAAGAGGTGTAAATAATGAGCTACCTTTTCTTCTAGGAAATATATTAATTAATTTTTCGAAGCGTAGAGCAAATAAAAGGAAAAGGCATCCTTTTGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	31.70%	0.13%	0.00%	NA
All Indica	2759	96.70%	3.20%	0.11%	0.00%	NA
All Japonica	1512	14.20%	85.80%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	88.20%	11.80%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.20%	3.60%	0.25%	0.00%	NA
Temperate Japonica	767	2.20%	97.80%	0.00%	0.00%	NA
Tropical Japonica	504	20.80%	79.20%	0.00%	0.00%	NA
Japonica Intermediate	241	38.20%	61.80%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	37.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017593628	C -> T	LOC_Os10g33420.1	upstream_gene_variant ; 1329.0bp to feature; MODIFIER	silent_mutation	Average:57.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N
vg1017593628	C -> T	LOC_Os10g33420-LOC_Os10g33430	intergenic_region ; MODIFIER	silent_mutation	Average:57.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017593628	NA	2.23E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017593628	NA	4.59E-28	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	4.05E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	2.52E-06	7.34E-06	mr1134	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	1.57E-09	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	3.84E-06	NA	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	3.41E-31	mr1546	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	4.45E-40	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	3.89E-14	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	1.40E-31	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	3.98E-24	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	1.18E-16	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	1.03E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	5.69E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017593628	NA	5.35E-36	mr1689_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251