\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017577102:

Variant ID: vg1017577102 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17577102
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGTGCGGCCGCGAGGCAGCATGCCGACGAGGCGCGCGGCCGGCGACGAGACAACACGATGATGAGGGGGACCAGCGACGAGGCGAGCGGGAGGGAGAC[C/T]
GACGCCGTCGTCGTGTTGTGGTGAGGAGGCCACACAACGACGCAGACGAGCGAGCGAGGGGAGTGGACGGGAGGTTGGCTACGGCGCGGGTGGCGCACAA

Reverse complement sequence

TTGTGCGCCACCCGCGCCGTAGCCAACCTCCCGTCCACTCCCCTCGCTCGCTCGTCTGCGTCGTTGTGTGGCCTCCTCACCACAACACGACGACGGCGTC[G/A]
GTCTCCCTCCCGCTCGCCTCGTCGCTGGTCCCCCTCATCATCGTGTTGTCTCGTCGCCGGCCGCGCGCCTCGTCGGCATGCTGCCTCGCGGCCGCACCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 30.10% 0.08% 0.00% NA
All Indica  2759 98.90% 1.10% 0.04% 0.00% NA
All Japonica  1512 14.60% 85.30% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.00% 2.80% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 2.30% 97.50% 0.13% 0.00% NA
Tropical Japonica  504 21.00% 78.80% 0.20% 0.00% NA
Japonica Intermediate  241 39.80% 60.20% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017577102 C -> T LOC_Os10g33390.1 upstream_gene_variant ; 3341.0bp to feature; MODIFIER silent_mutation Average:82.273; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg1017577102 C -> T LOC_Os10g33400.1 upstream_gene_variant ; 955.0bp to feature; MODIFIER silent_mutation Average:82.273; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg1017577102 C -> T LOC_Os10g33410.1 upstream_gene_variant ; 3921.0bp to feature; MODIFIER silent_mutation Average:82.273; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg1017577102 C -> T LOC_Os10g33380.1 downstream_gene_variant ; 1153.0bp to feature; MODIFIER silent_mutation Average:82.273; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg1017577102 C -> T LOC_Os10g33380-LOC_Os10g33400 intergenic_region ; MODIFIER silent_mutation Average:82.273; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017577102 C T 0.08 0.04 0.01 0.02 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017577102 NA 1.76E-101 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 4.08E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.09E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 2.99E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 2.30E-06 1.31E-85 mr1134 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 9.92E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 5.67E-07 7.71E-85 mr1135 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 2.85E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 1.98E-06 2.14E-94 mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 2.54E-06 8.77E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 7.75E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.46E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 6.74E-37 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 5.67E-86 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 2.98E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.19E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.96E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 4.45E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.47E-101 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 6.20E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.82E-39 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 2.55E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017577102 NA 1.20E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251