\
| Variant ID: vg1017569988 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17569988 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 94. )
TTATTCTAAACATGAGATTTGTTTTCTTGGGAACAAAATAAAAGGCCCACCCTTTTGCTTATTCCTGGAATAAGCGAAACGAAGTGATCTTTGAATAAAC[C/T]
TTTATATACATGTTCTTAACGATCTAAAAGCAAAGGTTGAAGAATAAACTTCGATGAAAAAAACCTTAAAATCACCTTCAAATTTAAGGTTAAAAATTTA
TAAATTTTTAACCTTAAATTTGAAGGTGATTTTAAGGTTTTTTTCATCGAAGTTTATTCTTCAACCTTTGCTTTTAGATCGTTAAGAACATGTATATAAA[G/A]
GTTTATTCAAAGATCACTTCGTTTCGCTTATTCCAGGAATAAGCAAAAGGGTGGGCCTTTTATTTTGTTCCCAAGAAAACAAATCTCATGTTTAGAATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 30.90% | 4.49% | 6.64% | NA |
| All Indica | 2759 | 79.90% | 2.20% | 7.29% | 10.62% | NA |
| All Japonica | 1512 | 13.30% | 85.60% | 0.46% | 0.66% | NA |
| Aus | 269 | 95.20% | 1.90% | 0.00% | 2.97% | NA |
| Indica I | 595 | 75.10% | 0.70% | 12.27% | 11.93% | NA |
| Indica II | 465 | 72.30% | 4.10% | 13.12% | 10.54% | NA |
| Indica III | 913 | 86.00% | 1.10% | 0.99% | 11.94% | NA |
| Indica Intermediate | 786 | 81.00% | 3.40% | 7.38% | 8.14% | NA |
| Temperate Japonica | 767 | 1.60% | 97.80% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 20.40% | 79.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 35.70% | 60.60% | 2.07% | 1.66% | NA |
| VI/Aromatic | 96 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 43.30% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017569988 | C -> T | LOC_Os10g33380.1 | upstream_gene_variant ; 4403.0bp to feature; MODIFIER | silent_mutation | Average:60.256; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg1017569988 | C -> T | LOC_Os10g33390.1 | downstream_gene_variant ; 2175.0bp to feature; MODIFIER | silent_mutation | Average:60.256; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg1017569988 | C -> T | LOC_Os10g33370.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.256; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg1017569988 | C -> DEL | N | N | silent_mutation | Average:60.256; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017569988 | NA | 6.52E-79 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 2.91E-87 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 4.11E-39 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 2.44E-32 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 6.81E-36 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 8.13E-82 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 3.82E-35 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 2.52E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 2.79E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017569988 | NA | 2.34E-41 | mr1689_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |