\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017498974:

Variant ID: vg1017498974 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17498974
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACATTCAGGATTTCAGGTCCTCAACTGAGGTGGTGTTTGGTTGGAGGAACTAAAGTGGGGCTAAACTTTAGTCCCTCTCATAAAAACATAAGTCCCTA[A/C]
TATAGGGACTTGTACTTTTGTGAGAGGGACTAAATTTAGTCTCTAGTTCCCAAACACCCCCTGAGAAGAGCAGAGGACAGCACACAGGACAATGCAACAC

Reverse complement sequence

GTGTTGCATTGTCCTGTGTGCTGTCCTCTGCTCTTCTCAGGGGGTGTTTGGGAACTAGAGACTAAATTTAGTCCCTCTCACAAAAGTACAAGTCCCTATA[T/G]
TAGGGACTTATGTTTTTATGAGAGGGACTAAAGTTTAGCCCCACTTTAGTTCCTCCAACCAAACACCACCTCAGTTGAGGACCTGAAATCCTGAATGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.90% 18.10% 12.15% 47.82% NA
All Indica  2759 2.40% 11.90% 14.79% 70.93% NA
All Japonica  1512 58.10% 30.30% 6.48% 5.09% NA
Aus  269 4.10% 18.20% 14.13% 63.57% NA
Indica I  595 3.70% 9.10% 20.00% 67.23% NA
Indica II  465 2.60% 15.70% 14.62% 67.10% NA
Indica III  913 0.30% 12.70% 10.84% 76.12% NA
Indica Intermediate  786 3.60% 10.90% 15.52% 69.97% NA
Temperate Japonica  767 41.60% 53.30% 3.65% 1.43% NA
Tropical Japonica  504 82.50% 3.20% 9.52% 4.76% NA
Japonica Intermediate  241 59.80% 13.70% 9.13% 17.43% NA
VI/Aromatic  96 63.50% 1.00% 16.67% 18.75% NA
Intermediate  90 23.30% 20.00% 15.56% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017498974 A -> C LOC_Os10g33304.1 downstream_gene_variant ; 2733.0bp to feature; MODIFIER silent_mutation Average:72.373; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg1017498974 A -> C LOC_Os10g33310.1 downstream_gene_variant ; 665.0bp to feature; MODIFIER silent_mutation Average:72.373; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg1017498974 A -> C LOC_Os10g33304-LOC_Os10g33310 intergenic_region ; MODIFIER silent_mutation Average:72.373; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg1017498974 A -> DEL N N silent_mutation Average:72.373; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017498974 NA 7.18E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1017498974 NA 5.69E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 9.25E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 4.60E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 2.06E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.10E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 7.69E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 6.06E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 8.09E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 3.32E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 8.72E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 8.39E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.99E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.83E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.36E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 3.82E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 6.24E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 2.40E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.07E-09 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 3.07E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.68E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.25E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.34E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 6.53E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 3.82E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 8.64E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.53E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 1.04E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 3.64E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 9.48E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.03E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 8.93E-10 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 2.21E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 9.33E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 4.93E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017498974 NA 2.45E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251