\
| Variant ID: vg1017458025 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17458025 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 109. )
GATTCCCAGCTCGTCACCGCCCCAAGGGCCGTCGTCGGAGACCTCTGGAACCGCTGTCGAGGAAAATCAATCTCTTCCACCGGACTCCCAGGCATCTGCC[G/A]
CCCCTAGGGCAGCCACCGTCAACGGGATCCGCCTCCTCACTGCGAACCTTGAACTGGCACTCAGGCTGCCACCGTCTCGGTTGGACGCTGCCCCTAGGGC
GCCCTAGGGGCAGCGTCCAACCGAGACGGTGGCAGCCTGAGTGCCAGTTCAAGGTTCGCAGTGAGGAGGCGGATCCCGTTGACGGTGGCTGCCCTAGGGG[C/T]
GGCAGATGCCTGGGAGTCCGGTGGAAGAGATTGATTTTCCTCGACAGCGGTTCCAGAGGTCTCCGACGACGGCCCTTGGGGCGGTGACGAGCTGGGAATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 41.70% | 0.06% | 0.25% | NA |
| All Indica | 2759 | 91.20% | 8.40% | 0.07% | 0.33% | NA |
| All Japonica | 1512 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 12.60% | 86.60% | 0.00% | 0.74% | NA |
| Indica I | 595 | 95.60% | 3.70% | 0.17% | 0.50% | NA |
| Indica II | 465 | 92.50% | 7.10% | 0.22% | 0.22% | NA |
| Indica III | 913 | 88.60% | 11.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 90.10% | 9.40% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017458025 | G -> A | LOC_Os10g33260.1 | missense_variant ; p.Ala62Thr; MODERATE | nonsynonymous_codon ; A62T | Average:71.97; most accessible tissue: Zhenshan97 panicle, score: 87.764 | unknown | unknown | DELETERIOUS | 0.00 |
| vg1017458025 | G -> DEL | LOC_Os10g33260.1 | N | frameshift_variant | Average:71.97; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017458025 | NA | 9.19E-24 | mr1020 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 3.03E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 4.33E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 5.06E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 6.99E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 1.36E-41 | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 7.32E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 2.60E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 3.82E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 1.18E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 6.91E-22 | mr1971 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 1.11E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017458025 | NA | 4.96E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |