\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017404944:

Variant ID: vg1017404944 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17404944
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATATGCATAAAAGCTTCAAACAAATATATAGTTCATGGGTAATTTTATCATCTTTGAGAAAGTACTGAAAGGTATCACATTTTCTAATGTAAAATTT[G/A]
GTACATCTAGATACAAAATATCTTGATGCACCAAAAATTTTAATATAAAATTTAGGTACCTCGAGGTATTTTTCTCAAGTACTATAAAATTGCTATGTTT

Reverse complement sequence

AAACATAGCAATTTTATAGTACTTGAGAAAAATACCTCGAGGTACCTAAATTTTATATTAAAATTTTTGGTGCATCAAGATATTTTGTATCTAGATGTAC[C/T]
AAATTTTACATTAGAAAATGTGATACCTTTCAGTACTTTCTCAAAGATGATAAAATTACCCATGAACTATATATTTGTTTGAAGCTTTTATGCATATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.40% 0.38% 0.00% NA
All Indica  2759 31.60% 67.80% 0.58% 0.00% NA
All Japonica  1512 91.80% 8.20% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 5.90% 93.80% 0.34% 0.00% NA
Indica II  465 23.90% 75.90% 0.22% 0.00% NA
Indica III  913 50.70% 48.70% 0.55% 0.00% NA
Indica Intermediate  786 33.50% 65.50% 1.02% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.80% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017404944 G -> A LOC_Os10g33200.1 downstream_gene_variant ; 4145.0bp to feature; MODIFIER silent_mutation Average:36.918; most accessible tissue: Callus, score: 73.663 N N N N
vg1017404944 G -> A LOC_Os10g33200-LOC_Os10g33204 intergenic_region ; MODIFIER silent_mutation Average:36.918; most accessible tissue: Callus, score: 73.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017404944 NA 4.75E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 1.74E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 6.27E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 2.56E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 2.45E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 6.78E-06 mr1691 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 1.50E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 3.41E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 1.77E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 4.69E-07 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 6.22E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944 NA 6.19E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251