Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017404944:

Variant ID: vg1017404944 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17404944
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TTCATATGCATAAAAGCTTCAAACAAATATATAGTTCATGGGTAATTTTATCATCTTTGAGAAAGTACTGAAAGGTATCACATTTTCTAATGTAAAATTT[G/A]
GTACATCTAGATACAAAATATCTTGATGCACCAAAAATTTTAATATAAAATTTAGGTACCTCGAGGTATTTTTCTCAAGTACTATAAAATTGCTATGTTT

Reverse complement sequence

AAACATAGCAATTTTATAGTACTTGAGAAAAATACCTCGAGGTACCTAAATTTTATATTAAAATTTTTGGTGCATCAAGATATTTTGTATCTAGATGTAC[C/T]
AAATTTTACATTAGAAAATGTGATACCTTTCAGTACTTTCTCAAAGATGATAAAATTACCCATGAACTATATATTTGTTTGAAGCTTTTATGCATATGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.20%	43.40%	0.38%	0.00%	NA
All Indica	2759	31.60%	67.80%	0.58%	0.00%	NA
All Japonica	1512	91.80%	8.20%	0.00%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	5.90%	93.80%	0.34%	0.00%	NA
Indica II	465	23.90%	75.90%	0.22%	0.00%	NA
Indica III	913	50.70%	48.70%	0.55%	0.00%	NA
Indica Intermediate	786	33.50%	65.50%	1.02%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	67.20%	32.80%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017404944	G -> A	LOC_Os10g33200.1	downstream_gene_variant ; 4145.0bp to feature; MODIFIER	silent_mutation	Average:36.918; most accessible tissue: Callus, score: 73.663	N	N	N	N
vg1017404944	G -> A	LOC_Os10g33200-LOC_Os10g33204	intergenic_region ; MODIFIER	silent_mutation	Average:36.918; most accessible tissue: Callus, score: 73.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017404944	NA	4.75E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	1.74E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	6.27E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	2.56E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	2.45E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	6.78E-06	mr1691	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	1.50E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	3.41E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	1.77E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	4.69E-07	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	6.22E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017404944	NA	6.19E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251