\
| Variant ID: vg1017360881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17360881 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 49. )
CGGTGAGATTGTTGCCGGCCATCCGCAGGTCCTGCAGCTTCATCAACTTCCCGAGCGACGCCGGAATCGAGCCGGAGAACGCATTGATGGACAGGTTGAG[G/A]
TACCTCAGATTCGGGAGCTTCTCCGGCAGCGTGTCCGGTATCTTCCCGAACAGAGTATTCTGCGACAGGTCGAGGTAGGTGATGTTGCCGCTCCTGAGGA
TCCTCAGGAGCGGCAACATCACCTACCTCGACCTGTCGCAGAATACTCTGTTCGGGAAGATACCGGACACGCTGCCGGAGAAGCTCCCGAATCTGAGGTA[C/T]
CTCAACCTGTCCATCAATGCGTTCTCCGGCTCGATTCCGGCGTCGCTCGGGAAGTTGATGAAGCTGCAGGACCTGCGGATGGCCGGCAACAATCTCACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 2.80% | 2.22% | 40.99% | NA |
| All Indica | 2759 | 32.10% | 4.40% | 2.90% | 60.60% | NA |
| All Japonica | 1512 | 91.00% | 0.40% | 0.79% | 7.80% | NA |
| Aus | 269 | 59.50% | 0.00% | 3.72% | 36.80% | NA |
| Indica I | 595 | 9.20% | 9.10% | 7.06% | 74.62% | NA |
| Indica II | 465 | 26.00% | 3.70% | 2.37% | 67.96% | NA |
| Indica III | 913 | 47.40% | 3.20% | 1.53% | 47.86% | NA |
| Indica Intermediate | 786 | 35.10% | 2.80% | 1.65% | 60.43% | NA |
| Temperate Japonica | 767 | 98.20% | 0.30% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 91.30% | 0.80% | 1.59% | 6.35% | NA |
| Japonica Intermediate | 241 | 67.60% | 0.00% | 1.24% | 31.12% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 67.80% | 2.20% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017360881 | G -> A | LOC_Os10g33130.1 | synonymous_variant ; p.Tyr247Tyr; LOW | synonymous_codon | Average:36.382; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| vg1017360881 | G -> DEL | LOC_Os10g33130.1 | N | frameshift_variant | Average:36.382; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017360881 | 2.87E-06 | 2.21E-10 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 8.59E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | 5.57E-07 | 1.84E-06 | mr1344 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 5.00E-06 | mr1344 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | 5.24E-06 | 1.01E-11 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 8.53E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 5.25E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 2.88E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 5.78E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | 5.85E-06 | 1.09E-07 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 1.24E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 1.56E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 3.02E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 2.47E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360881 | NA | 6.33E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |