\
| Variant ID: vg1017360795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17360795 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGGCGGGATCGCCCCGCCGAGCTGGTTGTCGCCGAGTTCAAGAATCCTCAATTGCGGCATCGACCCAAGGAACTCCGGGATGCCGCCGGTGAGATTGTTG[C/G]
CGGCCATCCGCAGGTCCTGCAGCTTCATCAACTTCCCGAGCGACGCCGGAATCGAGCCGGAGAACGCATTGATGGACAGGTTGAGGTACCTCAGATTCGG
CCGAATCTGAGGTACCTCAACCTGTCCATCAATGCGTTCTCCGGCTCGATTCCGGCGTCGCTCGGGAAGTTGATGAAGCTGCAGGACCTGCGGATGGCCG[G/C]
CAACAATCTCACCGGCGGCATCCCGGAGTTCCTTGGGTCGATGCCGCAATTGAGGATTCTTGAACTCGGCGACAACCAGCTCGGCGGGGCGATCCCGCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 2.20% | 10.52% | 43.12% | NA |
| All Indica | 2759 | 28.90% | 3.40% | 5.58% | 62.12% | NA |
| All Japonica | 1512 | 78.60% | 0.50% | 13.03% | 7.87% | NA |
| Aus | 269 | 5.90% | 0.00% | 39.41% | 54.65% | NA |
| Indica I | 595 | 8.20% | 8.90% | 7.56% | 75.29% | NA |
| Indica II | 465 | 23.00% | 4.30% | 3.87% | 68.82% | NA |
| Indica III | 913 | 43.50% | 0.10% | 5.70% | 50.71% | NA |
| Indica Intermediate | 786 | 30.90% | 2.70% | 4.96% | 61.45% | NA |
| Temperate Japonica | 767 | 97.90% | 0.30% | 0.39% | 1.43% | NA |
| Tropical Japonica | 504 | 57.70% | 0.80% | 34.72% | 6.75% | NA |
| Japonica Intermediate | 241 | 61.00% | 0.40% | 7.88% | 30.71% | NA |
| VI/Aromatic | 96 | 34.40% | 1.00% | 35.42% | 29.17% | NA |
| Intermediate | 90 | 57.80% | 2.20% | 6.67% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017360795 | C -> G | LOC_Os10g33130.1 | missense_variant ; p.Gly276Ala; MODERATE | nonsynonymous_codon ; G276A | Average:37.719; most accessible tissue: Zhenshan97 flower, score: 75.657 | benign |
0.073 |
TOLERATED | 1.00 |
| vg1017360795 | C -> DEL | LOC_Os10g33130.1 | N | frameshift_variant | Average:37.719; most accessible tissue: Zhenshan97 flower, score: 75.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017360795 | NA | 4.27E-08 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 2.08E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | 6.05E-06 | NA | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 5.72E-06 | mr1344 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 1.13E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 2.70E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 3.64E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 4.80E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | 6.82E-06 | 1.40E-07 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | 2.14E-06 | 5.23E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | 2.91E-06 | NA | mr1798 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | 2.70E-06 | 4.22E-07 | mr1798 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 4.33E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017360795 | NA | 2.38E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |