\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017322255:

Variant ID: vg1017322255 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17322255
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCTGCGGCATTGGTTGATGCTGGCATGACGGCGGCCGCCACGAAGAGGAGGAGGAGGAGGAAACGGTGGACGACGCCGGCCATGCGGGCAGTCGGTTC[T/G]
TTCATGGCAGAGGCGTACGTAGCGAGCAGACACACGGAGGAAGACACGATCGATATATCGAGCTGATCGTCTCCGGCTGTGCAGGTCGGTGAATTTTTTT

Reverse complement sequence

AAAAAAATTCACCGACCTGCACAGCCGGAGACGATCAGCTCGATATATCGATCGTGTCTTCCTCCGTGTGTCTGCTCGCTACGTACGCCTCTGCCATGAA[A/C]
GAACCGACTGCCCGCATGGCCGGCGTCGTCCACCGTTTCCTCCTCCTCCTCCTCTTCGTGGCGGCCGCCGTCATGCCAGCATCAACCAATGCCGCAGCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.20% 0.32% 0.00% NA
All Indica  2759 75.00% 24.60% 0.43% 0.00% NA
All Japonica  1512 22.70% 77.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.80% 3.40% 0.84% 0.00% NA
Indica II  465 79.40% 20.60% 0.00% 0.00% NA
Indica III  913 61.30% 38.20% 0.44% 0.00% NA
Indica Intermediate  786 72.40% 27.20% 0.38% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 44.20% 55.80% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017322255 T -> G LOC_Os10g33050.1 upstream_gene_variant ; 4333.0bp to feature; MODIFIER silent_mutation Average:88.997; most accessible tissue: Minghui63 root, score: 97.041 N N N N
vg1017322255 T -> G LOC_Os10g33060.1 upstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:88.997; most accessible tissue: Minghui63 root, score: 97.041 N N N N
vg1017322255 T -> G LOC_Os10g33070.1 upstream_gene_variant ; 2814.0bp to feature; MODIFIER silent_mutation Average:88.997; most accessible tissue: Minghui63 root, score: 97.041 N N N N
vg1017322255 T -> G LOC_Os10g33040.1 downstream_gene_variant ; 4333.0bp to feature; MODIFIER silent_mutation Average:88.997; most accessible tissue: Minghui63 root, score: 97.041 N N N N
vg1017322255 T -> G LOC_Os10g33060-LOC_Os10g33070 intergenic_region ; MODIFIER silent_mutation Average:88.997; most accessible tissue: Minghui63 root, score: 97.041 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017322255 T G -0.04 -0.01 -0.01 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017322255 NA 9.79E-07 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017322255 NA 4.10E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017322255 NA 1.07E-06 mr1691_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251