\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017312673:

Variant ID: vg1017312673 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17312673
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCCTCGACGCGCTCGACTTCGCGGCGCTCCCGGCGCTGGCCGAGCTCGACCTCAACGGGAACAACTTCACCGGCGCCATCCCGGCGAGCATCTCGCGG[C/G]
TCCGCTCGCTGGCCTCGCTCGACCTCGGCAACAATGGCTTCAGCGACTCCATCCCGCCGCAGCTCGGCGACCTCTCCGGCCTCGTCGACCTCCGCCTCTA

Reverse complement sequence

TAGAGGCGGAGGTCGACGAGGCCGGAGAGGTCGCCGAGCTGCGGCGGGATGGAGTCGCTGAAGCCATTGTTGCCGAGGTCGAGCGAGGCCAGCGAGCGGA[G/C]
CCGCGAGATGCTCGCCGGGATGGCGCCGGTGAAGTTGTTCCCGTTGAGGTCGAGCTCGGCCAGCGCCGGGAGCGCCGCGAAGTCGAGCGCGTCGAGGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 0.40% 3.15% 0.00% NA
All Indica  2759 99.60% 0.20% 0.22% 0.00% NA
All Japonica  1512 90.10% 0.60% 9.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 73.20% 1.80% 25.00% 0.00% NA
Japonica Intermediate  241 94.60% 0.00% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017312673 C -> G LOC_Os10g33040.1 missense_variant ; p.Leu115Val; MODERATE nonsynonymous_codon ; L115V Average:88.613; most accessible tissue: Zhenshan97 flag leaf, score: 97.745 benign 0.808 DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017312673 C G 0.0 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017312673 6.63E-06 1.24E-10 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 6.85E-06 3.41E-06 mr1344 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 2.57E-10 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 1.22E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 2.90E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 6.88E-06 mr1676 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 1.73E-07 4.16E-09 mr1716 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 1.50E-06 5.57E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 6.33E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 9.55E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 6.71E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017312673 NA 3.30E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251