Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017311627:

Variant ID: vg1017311627 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17311627
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCCCGTGGTTCCTAAATTCCTAGGACACATAGGACCATGATTATGATTACTGCCCATCTCAAAATATAAAAATTTAGAATCACATAATCTCTCCATCC[C/T]
ATAAAAAACAATCTAATACTAGATGTGACATATCCTAATATTACGAGTCTGGACATACATCTGTCTAGATTCATTATACTAGAATATGTCACATCCAGTA

Reverse complement sequence

TACTGGATGTGACATATTCTAGTATAATGAATCTAGACAGATGTATGTCCAGACTCGTAATATTAGGATATGTCACATCTAGTATTAGATTGTTTTTTAT[G/A]
GGATGGAGAGATTATGTGATTCTAAATTTTTATATTTTGAGATGGGCAGTAATCATAATCATGGTCCTATGTGTCCTAGGAATTTAGGAACCACGGGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 28.00% 0.40% 4.27% NA
All Indica  2759 64.40% 35.10% 0.47% 0.00% NA
All Japonica  1512 85.30% 1.40% 0.13% 13.16% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 80.30% 19.50% 0.17% 0.00% NA
Indica II  465 74.20% 25.40% 0.43% 0.00% NA
Indica III  913 49.20% 50.50% 0.33% 0.00% NA
Indica Intermediate  786 64.40% 34.70% 0.89% 0.00% NA
Temperate Japonica  767 99.20% 0.40% 0.00% 0.39% NA
Tropical Japonica  504 61.30% 2.60% 0.40% 35.71% NA
Japonica Intermediate  241 91.30% 2.10% 0.00% 6.64% NA
VI/Aromatic  96 35.40% 63.50% 1.04% 0.00% NA
Intermediate  90 63.30% 30.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017311627 C -> T LOC_Os10g33040.1 upstream_gene_variant ; 634.0bp to feature; MODIFIER silent_mutation Average:87.03; most accessible tissue: Zhenshan97 flag leaf, score: 96.532 N N N N
vg1017311627 C -> T LOC_Os10g33050.1 downstream_gene_variant ; 4561.0bp to feature; MODIFIER silent_mutation Average:87.03; most accessible tissue: Zhenshan97 flag leaf, score: 96.532 N N N N
vg1017311627 C -> T LOC_Os10g33030-LOC_Os10g33040 intergenic_region ; MODIFIER silent_mutation Average:87.03; most accessible tissue: Zhenshan97 flag leaf, score: 96.532 N N N N
vg1017311627 C -> DEL N N silent_mutation Average:87.03; most accessible tissue: Zhenshan97 flag leaf, score: 96.532 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017311627 C T 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017311627 NA 5.46E-07 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 3.55E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 2.18E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 9.37E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 4.98E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 5.55E-08 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 1.23E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 6.03E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 4.71E-06 1.15E-06 mr1952 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 3.73E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017311627 NA 5.44E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251