\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017286875:

Variant ID: vg1017286875 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17286875
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATAACCGCCATGTAGATATGGGGTAACCATAATCTCCACAGTAACTATCGAAACAAGATTTTGGCAATAATAAAAGGGGGTGGCTATCAAGCTAGGAAA[A/G]
TGGATGGGTTTGAAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTATCCGGTAATTCTGATGATGAAAAGACT

Reverse complement sequence

AGTCTTTTCATCATCAGAATTACCGGATAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTTCAAACCCATCCA[T/C]
TTTCCTAGCTTGATAGCCACCCCCTTTTATTATTGCCAAAATCTTGTTTCGATAGTTACTGTGGAGATTATGGTTACCCCATATCTACATGGCGGTTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 26.30% 0.06% 0.00% NA
All Indica  2759 98.50% 1.40% 0.11% 0.00% NA
All Japonica  1512 23.30% 76.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 45.60% 54.40% 0.00% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017286875 A -> G LOC_Os10g33010.1 upstream_gene_variant ; 548.0bp to feature; MODIFIER silent_mutation Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 N N N N
vg1017286875 A -> G LOC_Os10g33020.1 downstream_gene_variant ; 3820.0bp to feature; MODIFIER silent_mutation Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 N N N N
vg1017286875 A -> G LOC_Os10g33010-LOC_Os10g33020 intergenic_region ; MODIFIER silent_mutation Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017286875 3.81E-06 NA mr1227 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 2.17E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 3.88E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 4.18E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 2.79E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 6.44E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 1.14E-46 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875 NA 1.25E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251