\
| Variant ID: vg1017286875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17286875 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )
TATAACCGCCATGTAGATATGGGGTAACCATAATCTCCACAGTAACTATCGAAACAAGATTTTGGCAATAATAAAAGGGGGTGGCTATCAAGCTAGGAAA[A/G]
TGGATGGGTTTGAAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTATCCGGTAATTCTGATGATGAAAAGACT
AGTCTTTTCATCATCAGAATTACCGGATAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTTCAAACCCATCCA[T/C]
TTTCCTAGCTTGATAGCCACCCCCTTTTATTATTGCCAAAATCTTGTTTCGATAGTTACTGTGGAGATTATGGTTACCCCATATCTACATGGCGGTTATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 26.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 23.30% | 76.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 58.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017286875 | A -> G | LOC_Os10g33010.1 | upstream_gene_variant ; 548.0bp to feature; MODIFIER | silent_mutation | Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 | N | N | N | N |
| vg1017286875 | A -> G | LOC_Os10g33020.1 | downstream_gene_variant ; 3820.0bp to feature; MODIFIER | silent_mutation | Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 | N | N | N | N |
| vg1017286875 | A -> G | LOC_Os10g33010-LOC_Os10g33020 | intergenic_region ; MODIFIER | silent_mutation | Average:46.264; most accessible tissue: Minghui63 root, score: 60.831 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017286875 | 3.81E-06 | NA | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 2.17E-38 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 3.88E-24 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 4.18E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 2.79E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 6.44E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 1.14E-46 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017286875 | NA | 1.25E-20 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |