Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1017286875:

Variant ID: vg1017286875 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17286875
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TATAACCGCCATGTAGATATGGGGTAACCATAATCTCCACAGTAACTATCGAAACAAGATTTTGGCAATAATAAAAGGGGGTGGCTATCAAGCTAGGAAA[A/G]
TGGATGGGTTTGAAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTATCCGGTAATTCTGATGATGAAAAGACT

Reverse complement sequence

AGTCTTTTCATCATCAGAATTACCGGATAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTTCAAACCCATCCA[T/C]
TTTCCTAGCTTGATAGCCACCCCCTTTTATTATTGCCAAAATCTTGTTTCGATAGTTACTGTGGAGATTATGGTTACCCCATATCTACATGGCGGTTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	26.30%	0.06%	0.00%	NA
All Indica	2759	98.50%	1.40%	0.11%	0.00%	NA
All Japonica	1512	23.30%	76.70%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	45.60%	54.40%	0.00%	0.00%	NA
Japonica Intermediate	241	41.90%	58.10%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017286875	A -> G	LOC_Os10g33010.1	upstream_gene_variant ; 548.0bp to feature; MODIFIER	silent_mutation	Average:46.264; most accessible tissue: Minghui63 root, score: 60.831	N	N	N	N
vg1017286875	A -> G	LOC_Os10g33020.1	downstream_gene_variant ; 3820.0bp to feature; MODIFIER	silent_mutation	Average:46.264; most accessible tissue: Minghui63 root, score: 60.831	N	N	N	N
vg1017286875	A -> G	LOC_Os10g33010-LOC_Os10g33020	intergenic_region ; MODIFIER	silent_mutation	Average:46.264; most accessible tissue: Minghui63 root, score: 60.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017286875	3.81E-06	NA	mr1227	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	2.17E-38	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	3.88E-24	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	4.18E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	2.79E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	6.44E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	1.14E-46	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017286875	NA	1.25E-20	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251