\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017244739:

Variant ID: vg1017244739 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17244739
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTGGTTACGTATATATATACTAGCAAAATGTCCGTGCTCCGCTACGGATATAATAAAATTAGAATAATTAAAGTAAAACTTAAATTATTTTTTTTAA[T/C]
CGAAGCTATTTTCACCCAGTGCTTTTGCTCGCTAAAATAAATCTCAAATTACGAAGGAAAATATGATAGCTCATGATAAACTAATTTAAAAGAATAGTTT

Reverse complement sequence

AAACTATTCTTTTAAATTAGTTTATCATGAGCTATCATATTTTCCTTCGTAATTTGAGATTTATTTTAGCGAGCAAAAGCACTGGGTGAAAATAGCTTCG[A/G]
TTAAAAAAAATAATTTAAGTTTTACTTTAATTATTCTAATTTTATTATATCCGTAGCGGAGCACGGACATTTTGCTAGTATATATATACGTAACCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 22.30% 0.04% 0.00% NA
All Indica  2759 99.10% 0.80% 0.07% 0.00% NA
All Japonica  1512 33.70% 66.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.80% 1.70% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 47.30% 52.70% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017244739 T -> C LOC_Os10g32950.1 upstream_gene_variant ; 3512.0bp to feature; MODIFIER silent_mutation Average:77.664; most accessible tissue: Callus, score: 92.38 N N N N
vg1017244739 T -> C LOC_Os10g32940.1 downstream_gene_variant ; 310.0bp to feature; MODIFIER silent_mutation Average:77.664; most accessible tissue: Callus, score: 92.38 N N N N
vg1017244739 T -> C LOC_Os10g32940-LOC_Os10g32950 intergenic_region ; MODIFIER silent_mutation Average:77.664; most accessible tissue: Callus, score: 92.38 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1017244739 T C 0.01 0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017244739 NA 3.74E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017244739 NA 1.39E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017244739 NA 4.43E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017244739 1.58E-07 4.70E-29 mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017244739 9.18E-06 9.18E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017244739 NA 5.86E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251