\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017238242:

Variant ID: vg1017238242 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17238242
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTGAAATCTCACACGAGATGCACTGTTGTAGAGTACTGCAACCGTTTAAATATATACTCCCTCCGTAAAAAAAAAACCATTCCTAGCATTCCAAAATG[A/G]
AAATAGTGGAGAGCGATAATGACTAAAATATCCTTAATCATTAAAAAAAAGTAATAAGAGTGGTAGGTAGGTAAAGGTATTGAAGGGATAAAGCTTCTCG

Reverse complement sequence

CGAGAAGCTTTATCCCTTCAATACCTTTACCTACCTACCACTCTTATTACTTTTTTTTAATGATTAAGGATATTTTAGTCATTATCGCTCTCCACTATTT[T/C]
CATTTTGGAATGCTAGGAATGGTTTTTTTTTTACGGAGGGAGTATATATTTAAACGGTTGCAGTACTCTACAACAGTGCATCTCGTGTGAGATTTCAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 26.30% 0.13% 0.08% NA
All Indica  2759 92.60% 7.20% 0.11% 0.04% NA
All Japonica  1512 33.20% 66.80% 0.00% 0.00% NA
Aus  269 98.50% 0.00% 0.37% 1.12% NA
Indica I  595 83.40% 16.60% 0.00% 0.00% NA
Indica II  465 91.00% 8.80% 0.00% 0.22% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 92.70% 7.10% 0.13% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 73.00% 27.00% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 52.30% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017238242 A -> G LOC_Os10g32930.1 downstream_gene_variant ; 1236.0bp to feature; MODIFIER silent_mutation Average:70.598; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg1017238242 A -> G LOC_Os10g32930-LOC_Os10g32940 intergenic_region ; MODIFIER silent_mutation Average:70.598; most accessible tissue: Minghui63 root, score: 89.793 N N N N
vg1017238242 A -> DEL N N silent_mutation Average:70.598; most accessible tissue: Minghui63 root, score: 89.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017238242 NA 9.64E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 6.09E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 2.54E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 1.80E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 1.61E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 5.10E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 2.11E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 4.73E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 1.13E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 3.09E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 1.70E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 8.55E-06 7.67E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 8.10E-07 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 6.48E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 2.82E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 5.51E-10 mr1815 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 4.02E-06 4.02E-06 mr1815 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242 NA 3.90E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251