Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017238242:

Variant ID: vg1017238242 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17238242
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTGAAATCTCACACGAGATGCACTGTTGTAGAGTACTGCAACCGTTTAAATATATACTCCCTCCGTAAAAAAAAAACCATTCCTAGCATTCCAAAATG[A/G]
AAATAGTGGAGAGCGATAATGACTAAAATATCCTTAATCATTAAAAAAAAGTAATAAGAGTGGTAGGTAGGTAAAGGTATTGAAGGGATAAAGCTTCTCG

Reverse complement sequence

CGAGAAGCTTTATCCCTTCAATACCTTTACCTACCTACCACTCTTATTACTTTTTTTTAATGATTAAGGATATTTTAGTCATTATCGCTCTCCACTATTT[T/C]
CATTTTGGAATGCTAGGAATGGTTTTTTTTTTACGGAGGGAGTATATATTTAAACGGTTGCAGTACTCTACAACAGTGCATCTCGTGTGAGATTTCAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	26.30%	0.13%	0.08%	NA
All Indica	2759	92.60%	7.20%	0.11%	0.04%	NA
All Japonica	1512	33.20%	66.80%	0.00%	0.00%	NA
Aus	269	98.50%	0.00%	0.37%	1.12%	NA
Indica I	595	83.40%	16.60%	0.00%	0.00%	NA
Indica II	465	91.00%	8.80%	0.00%	0.22%	NA
Indica III	913	99.30%	0.40%	0.22%	0.00%	NA
Indica Intermediate	786	92.70%	7.10%	0.13%	0.00%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	73.00%	27.00%	0.00%	0.00%	NA
Japonica Intermediate	241	47.70%	52.30%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	10.40%	1.04%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017238242	A -> G	LOC_Os10g32930.1	downstream_gene_variant ; 1236.0bp to feature; MODIFIER	silent_mutation	Average:70.598; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg1017238242	A -> G	LOC_Os10g32930-LOC_Os10g32940	intergenic_region ; MODIFIER	silent_mutation	Average:70.598; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N
vg1017238242	A -> DEL	N	N	silent_mutation	Average:70.598; most accessible tissue: Minghui63 root, score: 89.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017238242	NA	9.64E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	6.09E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	2.54E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	1.80E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	1.61E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	5.10E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	2.11E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	4.73E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	1.13E-07	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	3.09E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	1.70E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	8.55E-06	7.67E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	8.10E-07	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	6.48E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	2.82E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	5.51E-10	mr1815	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	4.02E-06	4.02E-06	mr1815	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017238242	NA	3.90E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251