Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017232696:

Variant ID: vg1017232696 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17232696
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATATTGCTTATATTTAATTCTGAATTTTAGTTAATTTTAAATTATATTCCTACTTGAACTCTTCTTTTCTTTTCCTTTTTCTAATTTTGATTTTTTTT[A/G,T]
TTTTTTATTCCGAAATTTAATTAATCTCGTATTGGATTCTTATATGACTCTTCTTTCAATATTTCTTATTTTTAATTCCGAATTTCTGCTATTTTTAAAT

Reverse complement sequence

ATTTAAAAATAGCAGAAATTCGGAATTAAAAATAAGAAATATTGAAAGAAGAGTCATATAAGAATCCAATACGAGATTAATTAAATTTCGGAATAAAAAA[T/C,A]
AAAAAAAATCAAAATTAGAAAAAGGAAAAGAAAAGAAGAGTTCAAGTAGGAATATAATTTAAAATTAACTAAAATTCAGAATTAAATATAAGCAATATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	2.20%	1.54%	0.00%	T: 0.06%
All Indica	2759	93.70%	3.70%	2.54%	0.00%	T: 0.11%
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.90%	10.30%	5.71%	0.00%	T: 0.17%
Indica II	465	94.00%	2.60%	3.44%	0.00%	NA
Indica III	913	99.20%	0.20%	0.33%	0.00%	T: 0.22%
Indica Intermediate	786	94.40%	3.40%	2.16%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017232696	A -> G	LOC_Os10g32920.1	upstream_gene_variant ; 3326.0bp to feature; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N
vg1017232696	A -> G	LOC_Os10g32930.1	upstream_gene_variant ; 4041.0bp to feature; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N
vg1017232696	A -> G	LOC_Os10g32920-LOC_Os10g32930	intergenic_region ; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N
vg1017232696	A -> T	LOC_Os10g32920.1	upstream_gene_variant ; 3326.0bp to feature; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N
vg1017232696	A -> T	LOC_Os10g32930.1	upstream_gene_variant ; 4041.0bp to feature; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N
vg1017232696	A -> T	LOC_Os10g32920-LOC_Os10g32930	intergenic_region ; MODIFIER	silent_mutation	Average:23.224; most accessible tissue: Callus, score: 34.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017232696	NA	1.44E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017232696	NA	2.09E-08	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017232696	1.17E-06	1.17E-06	mr1442	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017232696	NA	9.24E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017232696	NA	2.19E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017232696	NA	6.96E-07	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251