\
| Variant ID: vg1017190380 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 17190380 |
| Reference Allele: CA | Alternative Allele: C,TA |
| Primary Allele: CA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
CAAAGTTCAGATTTTTCATAGCAAAGGTTAACAACTACAAAAATCGAGAAAATTGGCATAATACCATCGTCAAAACAGGTTTCGCCCAAATACCACTATG[CA/C,TA]
GTTGGGATTCGCCAAAATATCATTCTCAATTGAGGGGCTTCGCCGAAACACCATTTTCTTCCAATTCTCTCTTTCCTTTCATCTTTGCTGACCAAAATGC
GCATTTTGGTCAGCAAAGATGAAAGGAAAGAGAGAATTGGAAGAAAATGGTGTTTCGGCGAAGCCCCTCAATTGAGAATGATATTTTGGCGAATCCCAAC[TG/G,TA]
CATAGTGGTATTTGGGCGAAACCTGTTTTGACGATGGTATTATGCCAATTTTCTCGATTTTTGTAGTTGTTAACCTTTGCTATGAAAAATCTGAACTTTG
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 1.70% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.90% | 5.30% | 2.78% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.00% | 9.50% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017190380 | CA -> C | LOC_Os10g32820.1 | upstream_gene_variant ; 4622.0bp to feature; MODIFIER | N | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> C | LOC_Os10g32840.1 | upstream_gene_variant ; 767.0bp to feature; MODIFIER | N | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> C | LOC_Os10g32830.1 | downstream_gene_variant ; 488.0bp to feature; MODIFIER | N | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> C | LOC_Os10g32850.1 | downstream_gene_variant ; 2433.0bp to feature; MODIFIER | N | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> C | LOC_Os10g32830-LOC_Os10g32840 | intergenic_region ; MODIFIER | N | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> TA | LOC_Os10g32820.1 | upstream_gene_variant ; 4621.0bp to feature; MODIFIER | silent_mutation | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> TA | LOC_Os10g32840.1 | upstream_gene_variant ; 768.0bp to feature; MODIFIER | silent_mutation | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> TA | LOC_Os10g32830.1 | downstream_gene_variant ; 487.0bp to feature; MODIFIER | silent_mutation | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> TA | LOC_Os10g32850.1 | downstream_gene_variant ; 2434.0bp to feature; MODIFIER | silent_mutation | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| vg1017190380 | CA -> TA | LOC_Os10g32830-LOC_Os10g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017190380 | NA | 2.22E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | 1.44E-07 | 1.44E-07 | mr1166 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 1.27E-10 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 2.44E-10 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 5.87E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | 9.89E-08 | 9.89E-08 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 1.95E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 1.13E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | 9.22E-06 | 2.20E-11 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | 1.97E-06 | 1.97E-06 | mr1649 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 5.73E-09 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 1.96E-06 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 1.72E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017190380 | NA | 8.91E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |