\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017190380:

Variant ID: vg1017190380 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 17190380
Reference Allele: CAAlternative Allele: C,TA
Primary Allele: CASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAGTTCAGATTTTTCATAGCAAAGGTTAACAACTACAAAAATCGAGAAAATTGGCATAATACCATCGTCAAAACAGGTTTCGCCCAAATACCACTATG[CA/C,TA]
GTTGGGATTCGCCAAAATATCATTCTCAATTGAGGGGCTTCGCCGAAACACCATTTTCTTCCAATTCTCTCTTTCCTTTCATCTTTGCTGACCAAAATGC

Reverse complement sequence

GCATTTTGGTCAGCAAAGATGAAAGGAAAGAGAGAATTGGAAGAAAATGGTGTTTCGGCGAAGCCCCTCAATTGAGAATGATATTTTGGCGAATCCCAAC[TG/G,TA]
CATAGTGGTATTTGGGCGAAACCTGTTTTGACGATGGTATTATGCCAATTTTCTCGATTTTTGTAGTTGTTAACCTTTGCTATGAAAAATCTGAACTTTG

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.70% 0.89% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.90% 5.30% 2.78% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 87.00% 9.50% 3.52% 0.00% NA
Tropical Japonica  504 97.60% 0.00% 2.38% 0.00% NA
Japonica Intermediate  241 95.90% 2.90% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017190380 CA -> C LOC_Os10g32820.1 upstream_gene_variant ; 4622.0bp to feature; MODIFIER N Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> C LOC_Os10g32840.1 upstream_gene_variant ; 767.0bp to feature; MODIFIER N Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> C LOC_Os10g32830.1 downstream_gene_variant ; 488.0bp to feature; MODIFIER N Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> C LOC_Os10g32850.1 downstream_gene_variant ; 2433.0bp to feature; MODIFIER N Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> C LOC_Os10g32830-LOC_Os10g32840 intergenic_region ; MODIFIER N Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> TA LOC_Os10g32820.1 upstream_gene_variant ; 4621.0bp to feature; MODIFIER silent_mutation Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> TA LOC_Os10g32840.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> TA LOC_Os10g32830.1 downstream_gene_variant ; 487.0bp to feature; MODIFIER silent_mutation Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> TA LOC_Os10g32850.1 downstream_gene_variant ; 2434.0bp to feature; MODIFIER silent_mutation Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1017190380 CA -> TA LOC_Os10g32830-LOC_Os10g32840 intergenic_region ; MODIFIER silent_mutation Average:53.641; most accessible tissue: Minghui63 root, score: 70.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017190380 NA 2.22E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 1.44E-07 1.44E-07 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 1.27E-10 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 2.44E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 5.87E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 9.89E-08 9.89E-08 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 1.95E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 1.13E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 9.22E-06 2.20E-11 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 1.97E-06 1.97E-06 mr1649 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 5.73E-09 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 1.96E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 1.72E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017190380 NA 8.91E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251