Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017131896:

Variant ID: vg1017131896 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17131896
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGGGTTGGTTTTCGTAATATATTATTATGCATGTTTTGTTACATGTAGATGCCAATTAAAACTTACCTAATTGAAACTGCAAACAAAGTTTCGTAATTAA[G/A]
GGAGTATAAGTAATCAGGATTATTTGTGCATCCTTAAAGTGCAGCGGTGGGGATATTTATTCCATTATTAAAAAGCAGCAAATTTGCAATACTACAATCG

Reverse complement sequence

CGATTGTAGTATTGCAAATTTGCTGCTTTTTAATAATGGAATAAATATCCCCACCGCTGCACTTTAAGGATGCACAAATAATCCTGATTACTTATACTCC[C/T]
TTAATTACGAAACTTTGTTTGCAGTTTCAATTAGGTAAGTTTTAATTGGCATCTACATGTAACAAAACATGCATAATAATATATTACGAAAACCAACCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	31.70%	2.88%	11.72%	NA
All Indica	2759	85.20%	1.60%	4.46%	8.70%	NA
All Japonica	1512	7.00%	91.70%	0.40%	0.93%	NA
Aus	269	14.90%	0.70%	0.00%	84.39%	NA
Indica I	595	79.30%	0.50%	11.76%	8.40%	NA
Indica II	465	86.90%	3.90%	4.30%	4.95%	NA
Indica III	913	89.70%	0.10%	0.33%	9.86%	NA
Indica Intermediate	786	83.50%	2.90%	3.82%	9.80%	NA
Temperate Japonica	767	1.80%	97.90%	0.26%	0.00%	NA
Tropical Japonica	504	5.00%	92.50%	0.60%	1.98%	NA
Japonica Intermediate	241	27.80%	70.10%	0.41%	1.66%	NA
VI/Aromatic	96	5.20%	29.20%	3.12%	62.50%	NA
Intermediate	90	41.10%	40.00%	4.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017131896	G -> A	LOC_Os10g32720.1	downstream_gene_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg1017131896	G -> A	LOC_Os10g32730.1	downstream_gene_variant ; 1256.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg1017131896	G -> A	LOC_Os10g32730.2	downstream_gene_variant ; 1256.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg1017131896	G -> A	LOC_Os10g32710-LOC_Os10g32720	intergenic_region ; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg1017131896	G -> DEL	N	N	silent_mutation	Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017131896	NA	4.84E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	4.39E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	2.69E-06	NA	mr1108	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.45E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	7.58E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.81E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.71E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	9.14E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.54E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	5.98E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	3.50E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	7.89E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	1.37E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	3.10E-10	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	4.45E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	3.35E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	8.50E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.64E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	2.52E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	9.82E-07	mr1783	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	1.88E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896	NA	1.79E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251