\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017131896:

Variant ID: vg1017131896 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17131896
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGTTGGTTTTCGTAATATATTATTATGCATGTTTTGTTACATGTAGATGCCAATTAAAACTTACCTAATTGAAACTGCAAACAAAGTTTCGTAATTAA[G/A]
GGAGTATAAGTAATCAGGATTATTTGTGCATCCTTAAAGTGCAGCGGTGGGGATATTTATTCCATTATTAAAAAGCAGCAAATTTGCAATACTACAATCG

Reverse complement sequence

CGATTGTAGTATTGCAAATTTGCTGCTTTTTAATAATGGAATAAATATCCCCACCGCTGCACTTTAAGGATGCACAAATAATCCTGATTACTTATACTCC[C/T]
TTAATTACGAAACTTTGTTTGCAGTTTCAATTAGGTAAGTTTTAATTGGCATCTACATGTAACAAAACATGCATAATAATATATTACGAAAACCAACCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 31.70% 2.88% 11.72% NA
All Indica  2759 85.20% 1.60% 4.46% 8.70% NA
All Japonica  1512 7.00% 91.70% 0.40% 0.93% NA
Aus  269 14.90% 0.70% 0.00% 84.39% NA
Indica I  595 79.30% 0.50% 11.76% 8.40% NA
Indica II  465 86.90% 3.90% 4.30% 4.95% NA
Indica III  913 89.70% 0.10% 0.33% 9.86% NA
Indica Intermediate  786 83.50% 2.90% 3.82% 9.80% NA
Temperate Japonica  767 1.80% 97.90% 0.26% 0.00% NA
Tropical Japonica  504 5.00% 92.50% 0.60% 1.98% NA
Japonica Intermediate  241 27.80% 70.10% 0.41% 1.66% NA
VI/Aromatic  96 5.20% 29.20% 3.12% 62.50% NA
Intermediate  90 41.10% 40.00% 4.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017131896 G -> A LOC_Os10g32720.1 downstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812 N N N N
vg1017131896 G -> A LOC_Os10g32730.1 downstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812 N N N N
vg1017131896 G -> A LOC_Os10g32730.2 downstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812 N N N N
vg1017131896 G -> A LOC_Os10g32710-LOC_Os10g32720 intergenic_region ; MODIFIER silent_mutation Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812 N N N N
vg1017131896 G -> DEL N N silent_mutation Average:65.825; most accessible tissue: Zhenshan97 flower, score: 83.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017131896 NA 4.84E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 4.39E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 2.69E-06 NA mr1108 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.45E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 7.58E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.81E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.71E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 9.14E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.54E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 5.98E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 3.50E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 7.89E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 1.37E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 3.10E-10 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 4.45E-06 mr1716 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 3.35E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 8.50E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.64E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 2.52E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 9.82E-07 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 1.88E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017131896 NA 1.79E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251