| Variant ID: vg1017130098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17130098 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 115. )
GAAACTTTCTAACACAAAATTTGAATCCTTTCAAGTCAAGATTTGAAATCTTTTAAGTCAAAATTAAAAACTTTCAATTGTATATTTGTAAAGAGTTGTG[C/T]
GAAAGATTGAAAAAAATTGGAAAGAAGCGGCACCTGCCCTTTTTTATCCAATGTGGAATCGACGACCTATGTATAAAAAAAGGAGAAAGTTTTTGAAGAA
TTCTTCAAAAACTTTCTCCTTTTTTTATACATAGGTCGTCGATTCCACATTGGATAAAAAAGGGCAGGTGCCGCTTCTTTCCAATTTTTTTCAATCTTTC[G/A]
CACAACTCTTTACAAATATACAATTGAAAGTTTTTAATTTTGACTTAAAAGATTTCAAATCTTGACTTGAAAGGATTCAAATTTTGTGTTAGAAAGTTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 31.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 8.30% | 91.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 92.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.50% | 70.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017130098 | C -> T | LOC_Os10g32720.1 | downstream_gene_variant ; 1818.0bp to feature; MODIFIER | silent_mutation | Average:29.918; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1017130098 | C -> T | LOC_Os10g32730.1 | downstream_gene_variant ; 3054.0bp to feature; MODIFIER | silent_mutation | Average:29.918; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1017130098 | C -> T | LOC_Os10g32730.2 | downstream_gene_variant ; 3054.0bp to feature; MODIFIER | silent_mutation | Average:29.918; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1017130098 | C -> T | LOC_Os10g32710-LOC_Os10g32720 | intergenic_region ; MODIFIER | silent_mutation | Average:29.918; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017130098 | NA | 1.19E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 1.22E-101 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 2.42E-08 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 9.94E-90 | mr1080 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | 3.71E-06 | 1.80E-09 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 3.23E-82 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 1.46E-07 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 7.14E-83 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | 7.47E-06 | 4.12E-104 | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017130098 | NA | 6.60E-10 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/