Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017129567:

Variant ID: vg1017129567 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17129567
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCCTTATCCAAAACTCCCTCCATATCCGAGGTCAGTTTCCGTATAAGACATGATATGTGGTGGGTCCTGCCGAGATTTAATCAACTACTATTAGATAT[G/A]
TGGTATCCATAACCCTGACAACGGTGATTAGAACGATTAGTACGGCGATTAGGGGATTATTGTGATTAGTTCAGATCTTTTTGTTTCTTTTCGAATAATT

Reverse complement sequence

AATTATTCGAAAAGAAACAAAAAGATCTGAACTAATCACAATAATCCCCTAATCGCCGTACTAATCGTTCTAATCACCGTTGTCAGGGTTATGGATACCA[C/T]
ATATCTAATAGTAGTTGATTAAATCTCGGCAGGACCCACCACATATCATGTCTTATACGGAAACTGACCTCGGATATGGAGGGAGTTTTGGATAAGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	5.90%	0.36%	0.00%	NA
All Indica	2759	93.10%	6.90%	0.00%	0.00%	NA
All Japonica	1512	93.30%	5.60%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.20%	16.80%	0.00%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.60%	0.00%	0.00%	NA
Temperate Japonica	767	88.10%	9.80%	2.09%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017129567	G -> A	LOC_Os10g32710.1	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32710.2	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32710.3	upstream_gene_variant ; 4791.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32720.1	downstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32730.1	downstream_gene_variant ; 3585.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32730.2	downstream_gene_variant ; 3585.0bp to feature; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N
vg1017129567	G -> A	LOC_Os10g32710-LOC_Os10g32720	intergenic_region ; MODIFIER	silent_mutation	Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017129567	NA	7.03E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	1.37E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	3.48E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	3.82E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	8.26E-06	6.58E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	2.42E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	2.00E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	4.10E-06	4.10E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	6.69E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	4.41E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	2.81E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	3.23E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	8.39E-06	8.39E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	2.64E-06	mr1716	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	6.83E-06	4.61E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	3.16E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	5.84E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	4.90E-07	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	2.98E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	4.05E-06	4.05E-06	mr1430_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	6.50E-08	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017129567	NA	1.33E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251