\
| Variant ID: vg1017129567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17129567 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )
TTTCCTTATCCAAAACTCCCTCCATATCCGAGGTCAGTTTCCGTATAAGACATGATATGTGGTGGGTCCTGCCGAGATTTAATCAACTACTATTAGATAT[G/A]
TGGTATCCATAACCCTGACAACGGTGATTAGAACGATTAGTACGGCGATTAGGGGATTATTGTGATTAGTTCAGATCTTTTTGTTTCTTTTCGAATAATT
AATTATTCGAAAAGAAACAAAAAGATCTGAACTAATCACAATAATCCCCTAATCGCCGTACTAATCGTTCTAATCACCGTTGTCAGGGTTATGGATACCA[C/T]
ATATCTAATAGTAGTTGATTAAATCTCGGCAGGACCCACCACATATCATGTCTTATACGGAAACTGACCTCGGATATGGAGGGAGTTTTGGATAAGGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 5.90% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.30% | 5.60% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.10% | 9.80% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017129567 | G -> A | LOC_Os10g32710.1 | upstream_gene_variant ; 4791.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32710.2 | upstream_gene_variant ; 4791.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32710.3 | upstream_gene_variant ; 4791.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32720.1 | downstream_gene_variant ; 2349.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32730.1 | downstream_gene_variant ; 3585.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32730.2 | downstream_gene_variant ; 3585.0bp to feature; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| vg1017129567 | G -> A | LOC_Os10g32710-LOC_Os10g32720 | intergenic_region ; MODIFIER | silent_mutation | Average:47.16; most accessible tissue: Zhenshan97 flower, score: 68.372 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017129567 | NA | 7.03E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 1.37E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 3.48E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 3.82E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | 8.26E-06 | 6.58E-06 | mr1344 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 2.42E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 2.00E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | 4.10E-06 | 4.10E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 6.69E-07 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 4.41E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 2.81E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 3.23E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | 8.39E-06 | 8.39E-06 | mr1649 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 2.64E-06 | mr1716 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | 6.83E-06 | 4.61E-07 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 3.16E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 5.84E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 4.90E-07 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 2.98E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | 4.05E-06 | 4.05E-06 | mr1430_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 6.50E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017129567 | NA | 1.33E-06 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |