\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017106956:

Variant ID: vg1017106956 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17106956
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTACTAAAACCCTAGACTGACTTGTTTTTGACAAATCTCACTTAAACGAGCGATCAAGATTTTTCCCTTGAACCACAAGAACAGATCCCAATTTTCCC[G/A,T]
GAACAAATCCAATTGCAAAGAACATATGCAATGAAAAGGATTCAGAGGGCTCTTAGGTTTTTCCATTTGGCTTGTCCTACGGTCAACCTGGCTCTGATAC

Reverse complement sequence

GTATCAGAGCCAGGTTGACCGTAGGACAAGCCAAATGGAAAAACCTAAGAGCCCTCTGAATCCTTTTCATTGCATATGTTCTTTGCAATTGGATTTGTTC[C/T,A]
GGGAAAATTGGGATCTGTTCTTGTGGTTCAAGGGAAAAATCTTGATCGCTCGTTTAAGTGAGATTTGTCAAAAACAAGTCAGTCTAGGGTTTTAGTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 11.90% 0.11% 0.02% A: 0.06%
All Indica  2759 99.40% 0.50% 0.04% 0.04% NA
All Japonica  1512 66.10% 33.50% 0.26% 0.00% A: 0.13%
Aus  269 99.30% 0.40% 0.00% 0.00% A: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 98.70% 1.10% 0.00% 0.13% NA
Temperate Japonica  767 97.10% 2.60% 0.00% 0.00% A: 0.26%
Tropical Japonica  504 15.10% 84.50% 0.40% 0.00% NA
Japonica Intermediate  241 74.30% 24.90% 0.83% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017106956 G -> T LOC_Os10g32649.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> T LOC_Os10g32658.1 upstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> T LOC_Os10g32670.1 downstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> T LOC_Os10g32658-LOC_Os10g32670 intergenic_region ; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> A LOC_Os10g32649.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> A LOC_Os10g32658.1 upstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> A LOC_Os10g32670.1 downstream_gene_variant ; 629.0bp to feature; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> A LOC_Os10g32658-LOC_Os10g32670 intergenic_region ; MODIFIER silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1017106956 G -> DEL N N silent_mutation Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017106956 NA 3.77E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 3.16E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.02E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 2.04E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.25E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.30E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.55E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.91E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 8.22E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.67E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 5.77E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.32E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 1.46E-06 1.13E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.89E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 4.96E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 4.63E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.04E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 8.57E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 3.79E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 9.43E-06 1.11E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.70E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.25E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 1.21E-06 NA mr1591_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 5.94E-06 NA mr1594_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 3.01E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 2.30E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.11E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 4.67E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 4.04E-08 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 2.86E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 7.84E-06 NA mr1890_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 3.35E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 7.94E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.75E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.18E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.30E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956 NA 1.73E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251