Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017106956:

Variant ID: vg1017106956 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17106956
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTACTAAAACCCTAGACTGACTTGTTTTTGACAAATCTCACTTAAACGAGCGATCAAGATTTTTCCCTTGAACCACAAGAACAGATCCCAATTTTCCC[G/A,T]
GAACAAATCCAATTGCAAAGAACATATGCAATGAAAAGGATTCAGAGGGCTCTTAGGTTTTTCCATTTGGCTTGTCCTACGGTCAACCTGGCTCTGATAC

Reverse complement sequence

GTATCAGAGCCAGGTTGACCGTAGGACAAGCCAAATGGAAAAACCTAAGAGCCCTCTGAATCCTTTTCATTGCATATGTTCTTTGCAATTGGATTTGTTC[C/T,A]
GGGAAAATTGGGATCTGTTCTTGTGGTTCAAGGGAAAAATCTTGATCGCTCGTTTAAGTGAGATTTGTCAAAAACAAGTCAGTCTAGGGTTTTAGTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	11.90%	0.11%	0.02%	A: 0.06%
All Indica	2759	99.40%	0.50%	0.04%	0.04%	NA
All Japonica	1512	66.10%	33.50%	0.26%	0.00%	A: 0.13%
Aus	269	99.30%	0.40%	0.00%	0.00%	A: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.70%	1.10%	0.00%	0.13%	NA
Temperate Japonica	767	97.10%	2.60%	0.00%	0.00%	A: 0.26%
Tropical Japonica	504	15.10%	84.50%	0.40%	0.00%	NA
Japonica Intermediate	241	74.30%	24.90%	0.83%	0.00%	NA
VI/Aromatic	96	74.00%	26.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017106956	G -> T	LOC_Os10g32649.1	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> T	LOC_Os10g32658.1	upstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> T	LOC_Os10g32670.1	downstream_gene_variant ; 629.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> T	LOC_Os10g32658-LOC_Os10g32670	intergenic_region ; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> A	LOC_Os10g32649.1	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> A	LOC_Os10g32658.1	upstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> A	LOC_Os10g32670.1	downstream_gene_variant ; 629.0bp to feature; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> A	LOC_Os10g32658-LOC_Os10g32670	intergenic_region ; MODIFIER	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1017106956	G -> DEL	N	N	silent_mutation	Average:44.011; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017106956	NA	3.77E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	3.16E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.02E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	2.04E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.25E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.30E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.55E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.91E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	8.22E-15	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.67E-09	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	5.77E-06	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.32E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	1.46E-06	1.13E-20	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.89E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	4.96E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	4.63E-13	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.04E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	8.57E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	3.79E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	9.43E-06	1.11E-13	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.70E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.25E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	1.21E-06	NA	mr1591_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	5.94E-06	NA	mr1594_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	3.01E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	2.30E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.11E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	4.67E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	4.04E-08	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	2.86E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	7.84E-06	NA	mr1890_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	3.35E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	7.94E-06	NA	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.75E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.18E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.30E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017106956	NA	1.73E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251