Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017101445:

Variant ID: vg1017101445 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 17101445
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGATGGTTCTGACTTTCTCTTCTGCTTCCCTTAGCACCTCTGTTCCAAACAGTTGACGCTCGCCTGTCTGATCCTAGAAGAGAGGGGTGCGACACTTCCG[G/A]
CCGTATAATGCTTCGAACGGTGCCATTTGAAGACTAGCCTGGTAACTGTTGTTGTAAGAGAACTCCGCATACGGTAAGGTTTTGTCCCAAGCTCCACCAA

Reverse complement sequence

TTGGTGGAGCTTGGGACAAAACCTTACCGTATGCGGAGTTCTCTTACAACAACAGTTACCAGGCTAGTCTTCAAATGGCACCGTTCGAAGCATTATACGG[C/T]
CGGAAGTGTCGCACCCCTCTCTTCTAGGATCAGACAGGCGAGCGTCAACTGTTTGGAACAGAGGTGCTAAGGGAAGCAGAAGAGAAAGTCAGAACCATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	1.00%	1.23%	1.78%	NA
All Indica	2759	93.40%	1.60%	1.96%	3.01%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	84.20%	3.70%	4.54%	7.56%	NA
Indica II	465	92.70%	1.70%	1.72%	3.87%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	93.50%	1.80%	2.29%	2.42%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.20%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1017101445	G -> A	LOC_Os10g32640.1	upstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841	N	N	N	N
vg1017101445	G -> A	LOC_Os10g32658.1	downstream_gene_variant ; 3982.0bp to feature; MODIFIER	silent_mutation	Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841	N	N	N	N
vg1017101445	G -> A	LOC_Os10g32649.1	intron_variant ; MODIFIER	silent_mutation	Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841	N	N	N	N
vg1017101445	G -> DEL	N	N	silent_mutation	Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1017101445	NA	3.19E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	9.75E-06	mr1511	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	4.67E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	6.65E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	4.78E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	1.17E-06	1.64E-08	mr1679	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	1.48E-06	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	3.32E-06	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	6.80E-06	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445	NA	1.06E-06	mr1928	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251