\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1017101445:

Variant ID: vg1017101445 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 17101445
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGATGGTTCTGACTTTCTCTTCTGCTTCCCTTAGCACCTCTGTTCCAAACAGTTGACGCTCGCCTGTCTGATCCTAGAAGAGAGGGGTGCGACACTTCCG[G/A]
CCGTATAATGCTTCGAACGGTGCCATTTGAAGACTAGCCTGGTAACTGTTGTTGTAAGAGAACTCCGCATACGGTAAGGTTTTGTCCCAAGCTCCACCAA

Reverse complement sequence

TTGGTGGAGCTTGGGACAAAACCTTACCGTATGCGGAGTTCTCTTACAACAACAGTTACCAGGCTAGTCTTCAAATGGCACCGTTCGAAGCATTATACGG[C/T]
CGGAAGTGTCGCACCCCTCTCTTCTAGGATCAGACAGGCGAGCGTCAACTGTTTGGAACAGAGGTGCTAAGGGAAGCAGAAGAGAAAGTCAGAACCATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 1.00% 1.23% 1.78% NA
All Indica  2759 93.40% 1.60% 1.96% 3.01% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.20% 3.70% 4.54% 7.56% NA
Indica II  465 92.70% 1.70% 1.72% 3.87% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 93.50% 1.80% 2.29% 2.42% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.20% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1017101445 G -> A LOC_Os10g32640.1 upstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 N N N N
vg1017101445 G -> A LOC_Os10g32658.1 downstream_gene_variant ; 3982.0bp to feature; MODIFIER silent_mutation Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 N N N N
vg1017101445 G -> A LOC_Os10g32649.1 intron_variant ; MODIFIER silent_mutation Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 N N N N
vg1017101445 G -> DEL N N silent_mutation Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1017101445 NA 3.19E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 9.75E-06 mr1511 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 4.67E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 6.65E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 4.78E-06 mr1571 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 1.17E-06 1.64E-08 mr1679 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 1.48E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 3.32E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 6.80E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1017101445 NA 1.06E-06 mr1928 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251