\
| Variant ID: vg1017101445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 17101445 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 254. )
TGATGGTTCTGACTTTCTCTTCTGCTTCCCTTAGCACCTCTGTTCCAAACAGTTGACGCTCGCCTGTCTGATCCTAGAAGAGAGGGGTGCGACACTTCCG[G/A]
CCGTATAATGCTTCGAACGGTGCCATTTGAAGACTAGCCTGGTAACTGTTGTTGTAAGAGAACTCCGCATACGGTAAGGTTTTGTCCCAAGCTCCACCAA
TTGGTGGAGCTTGGGACAAAACCTTACCGTATGCGGAGTTCTCTTACAACAACAGTTACCAGGCTAGTCTTCAAATGGCACCGTTCGAAGCATTATACGG[C/T]
CGGAAGTGTCGCACCCCTCTCTTCTAGGATCAGACAGGCGAGCGTCAACTGTTTGGAACAGAGGTGCTAAGGGAAGCAGAAGAGAAAGTCAGAACCATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 1.00% | 1.23% | 1.78% | NA |
| All Indica | 2759 | 93.40% | 1.60% | 1.96% | 3.01% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.20% | 3.70% | 4.54% | 7.56% | NA |
| Indica II | 465 | 92.70% | 1.70% | 1.72% | 3.87% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 93.50% | 1.80% | 2.29% | 2.42% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1017101445 | G -> A | LOC_Os10g32640.1 | upstream_gene_variant ; 2933.0bp to feature; MODIFIER | silent_mutation | Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 | N | N | N | N |
| vg1017101445 | G -> A | LOC_Os10g32658.1 | downstream_gene_variant ; 3982.0bp to feature; MODIFIER | silent_mutation | Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 | N | N | N | N |
| vg1017101445 | G -> A | LOC_Os10g32649.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 | N | N | N | N |
| vg1017101445 | G -> DEL | N | N | silent_mutation | Average:53.445; most accessible tissue: Minghui63 flower, score: 63.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1017101445 | NA | 3.19E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 9.75E-06 | mr1511 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 4.67E-06 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 6.65E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 4.78E-06 | mr1571 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | 1.17E-06 | 1.64E-08 | mr1679 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 1.48E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 3.32E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 6.80E-06 | mr1804 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1017101445 | NA | 1.06E-06 | mr1928 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |